The impact of the presence of youngsters on grownup smoking behaviour: empirical proof primarily based on China household panel research

Background: Regardless of a lot of research linking household and marriage elements with well being behaviour, the consequences of youngsters on the well being behaviour of oldsters are nonetheless understudied. This examine explored the affiliation between the presence of youngsters and adults’ smoking behaviours.

 

Strategies: This examine used panel knowledge from the China Household Panel Research 2010 and 2012, and the information set included 23,157 households and 45,513 adults. Logistic regression was carried out to analyse the affiliation of the presence of youngsters on adults’ smoking behaviours. Subgroup regression was used to look at heterogeneous results.

 

Outcomes: Full pattern regressions confirmed that the variety of youngsters was considerably inversely related to smoking behaviour (OR = 0.93; 95% 0.90-0.96). Additional subsample regression finds that such impact is just vital among the many high-education group (OR = 0.92; 95% 0.87-0.97), high-skill employees (OR = 0.89; 95% 0.80-0.99) and {couples} who had an age hole better than 2 years (OR = 0.91; 95% 0.88-0.95).

 

Conclusions: Our findings affirm the existence of the upward intergenerational impact of the presence of youngsters on adults’ smoking behaviour in China. Nonetheless, such results are usually not equal throughout all demographic traits. Future analysis might discover different elements of the upward mechanism and potential pathways for a stronger impact. In resource-poor areas, focusing on cessation actions at those that have youngsters at an early age could also be an efficient technique.

gemini-genomics
gemini-genomics

NATtrol Flu Verification Panel (7 X 0.5 mL)

NATFVP-NNS 7 X 0.5 mL
EUR 394.24
  • What is the product classification?
  • NATtrol Flu Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218.00

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485.00

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218.00

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485.00

Porcine Swine FLU virus A (FLU A) ELISA Kit

QY-E40037 96T
EUR 400.00

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886.00

Human FLU ELISA Kit

EHF0241 96Tests
EUR 521.00

Goat FLU ELISA Kit

EGTF0241 96Tests
EUR 521.00

Bovine FLU ELISA Kit

EBF0241 96Tests
EUR 521.00

Canine FLU ELISA Kit

ECF0241 96Tests
EUR 521.00

Anserine FLU ELISA Kit

EAF0241 96Tests
EUR 521.00

Mouse FLU ELISA Kit

EMF0241 96Tests
EUR 521.00

Rat FLU ELISA Kit

ERF0241 96Tests
EUR 521.00

Rabbit FLU ELISA Kit

ERTF0241 96Tests
EUR 521.00

Porcine FLU ELISA Kit

EPF0241 96Tests
EUR 521.00

IVD antibody

22140-100ul 100ul
EUR 390.00

IVD antibody

70R-18039 50 ul
EUR 435.00
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691.00
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304.00
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-IVD

YF-PA12811 50 ug
EUR 363.00
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403.00
Description: Rabbit polyclonal to IVD

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA

BBV15-N-100 100 ug
EUR 286.00

Human FLU-H5 ELISA Kit

201-12-2128 96 tests
EUR 440.00
  • This FLU-H5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

FLU-A DOT-ELISA Kit

DEIA436 6T/30T
EUR 580.00
Description: This kit is an in vitro immunoassay test (Dot-ELISA) for the direct, rapid and qualitative detection of nucleoprotein (NP) antigen of Influenza A Virus in human nasopharyngeal aspirates, swabs, nasal wash, chicken embryo whole virus inoculation or viral lysates, etc. It is intended for clinical identification influenza type-A viruses.

Guinea Pig FLU ELISA Kit

EGF0241 96Tests
EUR 521.00

Human FLU-H5 ELISA Kit

QY-E04880 96T
EUR 361.00

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252.00

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187.00

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308.00

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459.00

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183.00

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223.00

Human IVD Antibody

33170-05111 150 ug
EUR 261.00

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195.00

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585.00
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody

PAab04426 100 ug
EUR 355.00

Anti-IVD antibody

STJ117476 100 µl
EUR 277.00
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510.00

IVD, Human Recombinant

P1577-20 20 µg
EUR 156.00

Saponin Vaccine Adjuvant

VAdv-Ly0009 1 g
EUR 1095.00
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant

AV-7010-50 50 ug
EUR 895.00

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103.00

IVD protein (His tag)

80R-1262 100 ug
EUR 268.00
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824.00

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928.00

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689.00

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865.00

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397.00

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for Age-BSA

2221-BSA
EUR 175.00

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224.00
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Calcium phosphate vaccine adjuvant

AV-1020-100 100 ml
EUR 219.00

Peanut Oil vaccine adjuvant

AV-5010-50 50 ml
EUR 225.00

Mineral Oil vaccine adjuvant

AV-5020-50 50 ml
EUR 225.00

Mannide monooleate vaccine adjuvant

AV-5030-5 5 g
EUR 164.00

HS15 Kolliphore vaccine adjuvant

AV-6010-100 100 g
EUR 286.00

Pam2CSK4 vaccine adjuvant, unlabeled

AV-9020-1 1 mg
EUR 408.00

Pam3CSK4 vaccine adjuvant, unlabeled

AV-9025-1 1 mg
EUR 286.00

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA

HPV618L13-S 1 ml
EUR 469.00

Human Influenza viruses IgG,FLU ELISA Kit

201-12-1767 96 tests
EUR 440.00
  • This Influenza viruses IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Pig Swine Influenza Virus (FLU) ELISA Kit

abx157184-96tests 96 tests
EUR 668.00
  • Shipped within 5-10 working days.

Human Influenza viruses IgG(FLU)ELISA Kit

GA-E1783HM-48T 48T
EUR 289.00

Human Influenza viruses IgG(FLU)ELISA Kit

GA-E1783HM-96T 96T
EUR 466.00

Human Influenza viruses IgG(FLU)ELISA Kit

QY-E02255 96T
EUR 361.00

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Rabbit Anti-West Nile Virus vaccine (WNV, Recombitek/DNA vaccine) antiserum

WNV13-S 100 ul
EUR 457.00

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85.00
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85.00
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133.00

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85.00
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98.00

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286.00

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164.00

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369.00

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506.00

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95.00

Ivd ORF Vector (Mouse) (pORF)

ORF048200 1.0 ug DNA
EUR 506.00

Peptidoglycan (S. aureus); vaccine adjuvant

AV-7045-25 25 mg
EUR 1017.00

Peptidoglycan (S. aureus); vaccine adjuvant

AV-7045-5 5 mg
EUR 286.00

RWJ 21757 Synthetic vaccine adjuvant

AV-9010-1 1 mg
EUR 164.00

RWJ 21757 Synthetic vaccine adjuvant

AV-9010-5 5 mg
EUR 286.00

Pam2CSK4 vaccine adjuvant; Biotin conjugate

AV-9020-B 1 mg
EUR 408.00

Pam2CSK4 vaccine adjuvant; Biotin conjugate

AV-9020-B-100 100 ug
EUR 164.00

Pam3CSK4 vaccine adjuvant; Biotin labelled

AV-9025-B 100 ug
EUR 347.00

Pam3CSK4 vaccine adjuvant; FITC labelled

AV-9025-F 100 ug
EUR 347.00

Pertussis Toxin B.Pertussis, vaccine grade

AV-9130-50 50 ug
EUR 529.00

Human Influenza viruses A,FLU A ELISA Kit

201-12-1596 96 tests
EUR 440.00
  • This Influenza viruses A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses B,FLU B ELISA Kit

201-12-2058 96 tests
EUR 440.00
  • This Influenza viruses B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses A(FLU A)ELISA Kit

GA-E1612HM-48T 48T
EUR 289.00

Human Influenza viruses A(FLU A)ELISA Kit

GA-E1612HM-96T 96T
EUR 466.00

Human Influenza viruses B(FLU B)ELISA Kit

QY-E02256 96T
EUR 361.00

Human Influenza viruses A(FLU A)ELISA Kit

QY-E02257 96T
EUR 361.00

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA

20021-1 100 ug
EUR 225.00

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-1 100 ug
EUR 225.00

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-2 100 ug
EUR 225.00

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20025-1 100 ug
EUR 225.00

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20026-1 100 ug
EUR 225.00

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20027-1 100 ug
EUR 225.00

Rabbit Anti-Gardasil vaccine (merck) antiserum (Human Papilloma Virus 16+18 (HPV16/18) late proteins L1 (HPV16+18L1) control for ELISA

HPV16181-S 500 ul
EUR 469.00

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)

MEK1010 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)

MEK1011 1 kit
EUR 1084.00

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)

MEK1012 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)

MEK1013 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)

MEK1015 1 kit
EUR 879.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)

MEK1016 1 kit
EUR 879.00

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column

FAPDE-holder-for-ion-exchange 1 prep
EUR 158.00

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgG antiserum negative control

970-360-01N 1 ml
EUR 164.00

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgG antiserum positive control

970-360-02P 1 ml
EUR 225.00

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgM antiserum negative control

970-370-01N 1 ml
EUR 164.00

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgM antiserum positive control

970-370-02P 1 ml
EUR 225.00

Mouse IgG (-ve control for flow cytometry)

20008-1-100 100 tests
EUR 103.00

Rabbit IgG (-ve control for flow cytometry)

20009-1-100 100 tests
EUR 103.00

Human Apolipoprotein B protein control for WB

APOB21-C 100 ul
EUR 286.00

Rec. Human CD21 protein control for WB

CD21-C 100 ul
EUR 286.00

Bovine Adenosine deaminase protein control for Western

ADA11-C 100 ul
EUR 286.00

Mouse Ceruloplasmin protein control for western blot

CP16-C 100 ul
EUR 286.00

Rat Ceruloplasmin protein control for western blot

CP17-C 100 ul
EUR 286.00

Haptoglobin Human Plasma protein control for WB

HGLB18-C 100 ul
EUR 286.00

Human Hemopexin purified protein control for Western

HPEX11-C 100 ul
EUR 286.00

Hemopexin Mouse, purified protein control for Western

HPEX16-C 100 ul
EUR 286.00

SLLK, Control Peptide for TSP1 Inhibitor(TFA)

HY-P0301A 5mg
EUR 380.00

Purified Flagellin (salmonella) protein control for WB

FLGN17-C 100 ul
EUR 286.00

Positive Control for Anti-Rat CYP3A2 Antibody

P3A2PTCON 100 uL
EUR 125.00

Positive Control for Anti-Human CYP3A Antibody

P3ACON 100 uL
EUR 125.00

Positive Control for Anti-Human CYP1A2 Antibody

P1A2CON 100 uL
EUR 125.00

Positive Control for Anti-Rat CYP2B1 Antibody

P2B1PTCON 100 uL
EUR 125.00

Positive Control for Anti-Rat CYP2C Antibody

P2CCON 100 uL
EUR 125.00

Positive Control for Anti-Rat CYP2D Antibody

P2DCON 100 uL
EUR 125.00

Positive Control for Anti-Human CYP2E1 Antibody

P2E1PTCON 100 uL
EUR 125.00

Purified bovine Lactoferrin protein control for Western

LTF13-C 100 ul
EUR 286.00

Mouse negative control sera (purified) for IHC

NCM802M 7 ml
EUR 199.00

Control/Blocking peptide for Ephrin-B2 antibody

NIVE2B-C 100 ug
EUR 164.00

Chicken Egg Ovalbumin protein control for Western

OVA11-C 100 ul
EUR 286.00

Positive Control for Anti-Rat MEH Antibody

MEHCON 100 uL
EUR 125.00

Control Sections for FD NeuroSilver™ Kit

PCS101 each
EUR 53.83
Description: Best quality products

Positive Control for Anti-Human CYP1B1 Antibody

PH1B1CON 100 uL
EUR 125.00

Purified, Bovine S100 protein control for WB

S1001-C 100 ul
EUR 286.00

Purified, Human S100 protein control for WB

S1002-C 100 ul
EUR 286.00

Control/Blocking peptide for Mouse Vimentin (Vim)

VIM11-C 100 ug
EUR 164.00

Control/Blocking peptide for Human WNT-1

WNT111-P 100 ug
EUR 457.00

Human IVD AssayLite Antibody (FITC Conjugate)

33170-05141 150 ug
EUR 428.00

Human IVD AssayLite Antibody (RPE Conjugate)

33170-05151 150 ug
EUR 428.00

In vitro cross-resistance to doravirine in a panel of HIV-1 clones harbouring a number of NNRTI resistance mutations

Goals: Doravirine is a not too long ago licensed HIV-1 NNRTI with improved efficacy, pharmacokinetics and security profile in contrast with efavirenz and restricted cross-resistance with rilpivirine and etravirine. On this in vitro examine, cross-resistance to doravirine was analysed in a consultant panel of NNRTI-resistant clones.

 

Strategies: In vitro phenotypic susceptibility to doravirine was assessed in 10 clinically derived infectious clones with intermediate- to high-level resistance to rilpivirine, etravirine, efavirenz and nevirapine, and in NL4-Three site-directed mutants harbouring Okay103N, Y181C, M230L or Okay103N/Y181C NNRTI mutations

 

Outcomes: Though not one of the infectious clones harboured any of the foremost doravirine resistance-associated mutations (RAMs) included within the IAS-USA reference listing, doravirine fold change (FC) values have been corresponding to or increased than these calculated for different NNRTIs, notably etravirine and rilpivirine.

 

As anticipated, single NNRTI mutations Okay103N and Y181C didn’t impair doravirine susceptibility (FC 1.Four and 1.8, respectively), whereas lowered exercise was noticed with the only M230L or double Okay103N/Y181C mutations (FC 7.6 and 4.9, respectively). Median FC values elevated considerably with rising numbers of NNRTI RAMs (P = 0.005) and have been >10 in 4/Four and 1/Four clones harbouring 4 and three NNRTI RAMs, respectively. FC values correlated nicely with predicted susceptibility as inferred by Stanford HIV Drug Resistance Database (HIVdb) and ANRS algorithms (each P < 0.001).

 

Conclusions: Substantial cross-resistance to doravirine was detected in NNRTI-resistant viruses harbouring advanced mutational patterns, even within the absence of main IAS-USA doravirine RAMs. Subsequently, primarily based on the easy IAS-USA reference listing, doravirine resistance could also be underestimated in viruses harbouring a number of NNRTI mutations.

Affiliation between adjustments in financial exercise and catastrophic well being expenditure: findings from the Korea Well being Panel Survey, 2014-2016

 

Background: The speed of catastrophic well being expenditure (CHE) continues to rise in South Korea. This examine examined the affiliation between adjustments in financial exercise and CHE experiences in South Korea.

 

Strategies: This examine analyzed the Korea Well being Panel Survey knowledge utilizing a logistic regression evaluation to review the affiliation between adjustments in financial exercise in 2014-2015 and the individuals’ CHE experiences in 2015. The examine included a complete of 12,454 people over the age of 19. The subgroup analyses have been organized by intercourse, age, health-related variables, and family degree variables, and the explanations for leaving financial exercise.

 

Outcomes: Those that stop financial actions have been extra prone to expertise CHE than those that continued to have interaction in financial actions (OR [odds ratio] = 2.10; 95% CI [confidence interval]: 1.31-3.36). The subgroup evaluation outcomes, in keeping with health-related variables, confirmed that there’s a tendency to a better Charlson comorbidity index, a better OR, and, in teams that stop their financial actions, folks with disabilities have been extra prone to expertise CHE than folks with out disabilities (OR = 5.63; 95% CI 1.71-18.59, OR = 1.82; 95% CI 1.08-3.08, respectively).

 

One other subgroup evaluation discovered that if the explanation for not collaborating in financial exercise was a health-related concern, the participant was extra prone to expertise CHE (lively → inactive: OR = 2.40; 95% CI 0.61-9.43, inactive → inactive OR = 1.65; 95% CI 1.01-2.68).

 

 

Conclusions: These people who turned unemployed have been extra prone to expertise CHE, particularly if well being issues precipitated the job loss. Subsequently, efforts are wanted to develop protection for these individuals who undergo from excessive medical bills.

Positive control tissue section for each antibody; Based on availability INQUIRE

Control-Slides Set of 5
EUR 176.00

SeroDetect HIV-Ab Verification Panel (5 X 1.5 mL)

KZMC006 5 X 1.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect HIV-Ab Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HBs Verification Panel (6 X 1.5 mL)

KZMC008 6 X 1.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect Anti-HBs Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HBcore Verification Panel (5 X 1.5 mL)

KZMC009 5 X 1.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect Anti-HBcore Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HCV Verification Panel (5 X 1.5 mL)

KZMC010 5 X 1.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect Anti-HCV Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HTLV Ab Verification Panel (5 X 1.5 mL)

KZMC011 5 X 1.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect HTLV Ab Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Dengue Fever Verification Panel (10 X 0.5 mL)

KZMC028 10 X 0.5 mL
EUR 272.56
  • What is the product classification?
  • SeroDetect Dengue Fever Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HIV-Ab Range Verification Panel (10 X 1.5 mL)

KZMC024 10 X 1.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect HIV-Ab Range Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect West Nile Virus Verification Panel (10 X 0.5 mL)

KZMC027 10 X 0.5 mL
EUR 278.80
  • What is the product classification?
  • SeroDetect West Nile Virus Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218.00

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485.00

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218.00

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485.00

Recombinant purified Hepatitis Surface Antigen (HBsAg) protein control for WB

HBA11-C 100 ul
EUR 286.00

SeroDetect HCV-Ab Mixed Titer Verification Panel I (15 X 0.25 mL)

KZMC022 15 X 0.25 mL
EUR 266.32
  • What is the product classification?
  • SeroDetect HCV-Ab Mixed Titer Verification Panel I is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HIV-1/ HIV-2 Ag/Ab Combo Verification Panel (5 X 1.25mL)

KZMC030 5 X 1.25mL
EUR 313.12
  • What is the product classification?
  • SeroDetect HIV-1/ HIV-2 Ag/Ab Combo Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886.00

IVD antibody

22140-100ul 100ul
EUR 390.00

IVD antibody

70R-18039 50 ul
EUR 435.00
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691.00
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304.00
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-IVD

YF-PA12811 50 ug
EUR 363.00
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403.00
Description: Rabbit polyclonal to IVD

HBsAg antibody

20C-CR2100G 1 ml
EUR 133.00
Description: Goat polyclonal HBsAg antibody

HBsAg antibody

20C-CR2100GP 1 ml
EUR 427.00
Description: Goat polyclonal HBsAg antibody

HbsAg antibody

20R-2830 1 ml
EUR 565.00
Description: Goat polyclonal HbsAg antibody

HBsAg antibody

70-1088 1 mg
EUR 219.00
Description: Goat polyclonal HBsAg antibody

HBsAg antibody

70-HH15 1 mg
EUR 258.00
Description: Horse polyclonal HBsAg antibody

HBsAg antibody

10R-H114c 1 mg
EUR 489.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10R-H114d 1 mg
EUR 472.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10C-CR1279M1 100 ug
EUR 281.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-1323 1 mg
EUR 136.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-1324 1 mg
EUR 136.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-3128 1 mg
EUR 230.00
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody

10-3130 1 mg
EUR 230.00
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody

10-3131 1 mg
EUR 230.00
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody

10-7857 1 mg
EUR 314.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-7858 1 mg
EUR 306.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05A 1 mg
EUR 220.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05B 1 mg
EUR 220.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05C 1 mg
EUR 592.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05D 1 mg
EUR 220.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05F 1 mg
EUR 220.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05G 1 mg
EUR 228.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05H 1 mg
EUR 228.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05J 1 mg
EUR 192.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05N 1 mg
EUR 220.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H114C 1 mg
EUR 336.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H114D 1 mg
EUR 325.00
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

20-HR20 1 mg
EUR 337.00
Description: Rabbit polyclonal HBsAg antibody

HBsAg antibody

70R-HG003 1 mg
EUR 246.00
Description: Goat polyclonal HBsAg antibody

HBsAg Protein

abx060551-1mg 1 mg
EUR 1553.00
  • Shipped within 5-10 working days.

HBsAg Protein

abx060552-1mg 1 mg
EUR 1010.00
  • Shipped within 5-10 working days.

HBsAg Protein

abx060560-1mg 1 mg
EUR 1121.00
  • Shipped within 5-10 working days.

HBsAg Protein

abx060562-1mg 1 mg
EUR 1567.00
  • Shipped within 5-10 working days.

HRP-HBsAg

C050101-10ml 10ml
EUR 2635.00

HRP-HBsAg

C050101-1ml 1ml
EUR 438.00

Hepatitis B Surface Antigen (HBsAg) pre-S1 peptide control/blocking peptide

HBVS12-P 100 ug
EUR 225.00

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252.00

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187.00

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308.00

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459.00

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183.00

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223.00

Human IVD Antibody

33170-05111 150 ug
EUR 261.00

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195.00

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585.00
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody

PAab04426 100 ug
EUR 355.00

Anti-IVD antibody

STJ117476 100 µl
EUR 277.00
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510.00

IVD, Human Recombinant

P1577-20 20 µg
EUR 156.00

Hepatitis B Surface Antigen (HBsAg) pre-S2 (55-aa) control/blocking peptide

HBVS23-P 100 ug
EUR 225.00

HBsAg antibody (biotin)

60C-CR2100GB 1 ml
EUR 457.00
Description: Goat polyclonal HBsAg antibody (biotin) conjugated

HBsAg antibody (FITC)

60C-CR2100GF 1 ml
EUR 363.00
Description: Goat polyclonal HBsAg antibody (FITC) conjugated

HBsAg antibody (HRP)

60C-CR2100GX 1 ml
EUR 451.00
Description: Goat polyclonal HBsAg antibody (HRP) conjugated

HBsAg antibody (biotin)

60C-CR2100RB 1 ml
EUR 453.00
Description: Rabbit polyclonal HBsAg antibody (biotin) conjugated

HBsAg antibody (FITC)

60C-CR2100RF 1 ml
EUR 385.00
Description: Rabbit polyclonal HBsAg antibody (FITC) conjugated

HBsAg antibody (HRP)

60C-CR2100RX 1 ml
EUR 445.00
Description: Rabbit polyclonal HBsAg antibody (HRP) conjugated

HBsAg antibody (biotin)

61-1066 1 ml
EUR 133.00
Description: Mouse monoclonal HBsAg antibody (biotin-conjugated)

Human HBsAg Protein

abx060118-1mg 1 mg
EUR 411.00
  • Shipped within 5-10 working days.

HBsAg ad Protein

abx060555-100ug 100 ug
EUR 878.00
  • Shipped within 5-10 working days.

HBsAg adr Protein

abx060556-05mg 0.5 mg
EUR 1567.00
  • Shipped within 5-10 working days.

HBsAg adw Protein

abx060557-01mg 0.1 mg
EUR 1017.00
  • Shipped within 5-10 working days.

HBsAg adw Protein

abx060558-05mg 0.5 mg
EUR 1295.00
  • Shipped within 5-10 working days.

HBsAg ay Protein

abx060563-100ug 100 ug
EUR 815.00
  • Shipped within 5-10 working days.

HBsAg ayw Protein

abx060565-05mg 0.5 mg
EUR 1358.00
  • Shipped within 5-10 working days.

HBsAg ayw Protein

abx060566-05mg 0.5 mg
EUR 1497.00
  • Shipped within 5-10 working days.

HBsAg adw Protein

abx060567-1mg 1 mg
EUR 1017.00
  • Shipped within 5-10 working days.

Anti-HBsAg antibody

STJ16101373 1 mg
EUR 538.00

Anti-HBsAg antibody

STJ180119 0.1 ml
EUR 212.00

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103.00

IVD protein (His tag)

80R-1262 100 ug
EUR 268.00
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824.00

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928.00

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689.00

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865.00

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397.00

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for Age-BSA

2221-BSA
EUR 175.00

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224.00
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

ELISA kit for Human HBsAg (Hepatitis B surface antigen)

E-EL-H1567 1 plate of 96 wells
EUR 534.00
  • Gentaur's HBsAg ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HBsAg. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HBsAg (Hepatitis B surface antigen) in samples from Serum, Plasma, Cell supernatant

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

HBsAg protein (Subtype adr)

30C-CP2019R 1 mg
EUR 573.00
Description: Purified recombinant HBsAg protein (Subtype adr)

HBsAg protein (Subtype adw)

30R-AH016 500 ug
EUR 732.00
Description: Purified recombinant HBsAg protein (Subtype adw)

HBsAg protein (Subtype ayw)

30R-AH018 500 ug
EUR 761.00
Description: Purified recombinant HBsAg protein (Subtype ayw)

HBsAg protein (subtype ad)

30-1815 500 ug
EUR 435.00
Description: Native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype ay)

30-1816 500 ug
EUR 381.00
Description: Purified Native Human HBsAg protein (Subtype ay)

HBsAg protein (Subtype ad)

30-AH15 1 mg
EUR 348.00
Description: Purified native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype adr)

30-AH37 1 mg
EUR 705.00
Description: Purified recombinant HBsAg protein (Subtype adr) (98% pure)

Anti-HBsAg Antibody (1C10E2)

A1372-1000
EUR 479.00

Anti-HBsAg Antibody (1G1A10)

A1373-1000
EUR 479.00

Anti-HBsAg Antibody (3G9F6)

A1374-1000
EUR 479.00

Anti-HBsAg (HBV) Purified

11-328-C025 0.025 mg
EUR 90.00

Anti-HBsAg (HBV) Purified

11-328-C100 0.1 mg
EUR 140.00

Anti-HBsAg (HBV) Purified

11-329-C025 0.025 mg
EUR 90.00

Anti-HBsAg (HBV) Purified

11-329-C100 0.1 mg
EUR 140.00

HBsAg antibody (Gold Colloid)

62-H05B 10 ml
EUR 457.00
Description: Mouse monoclonal HBsAg antibody (Gold Colloid)

Human HBsAg ELISA Kit

DEIA001 96T
EUR 485.00
Description: 1. For screening of blood donors. 2. As an aid in the diagnosis of liver disease.

HBV antigen HBsAg Antibody

abx140205-01mg 0.1 mg
EUR 328.00
  • Shipped within 5-12 working days.

HBV antigen HBsAg Antibody

abx140206-01mg 0.1 mg
EUR 328.00
  • Shipped within 5-12 working days.

Human HBsAg ELISA Kit

EHH0214 96Tests
EUR 521.00

Canine HBsAg Elisa Kit

ELA-E0940d 96 Tests
EUR 928.00

Goat HBsAg ELISA Kit

EGTH0214 96Tests
EUR 521.00

Bovine HBsAg ELISA Kit

EBH0214 96Tests
EUR 521.00

Canine HBsAg ELISA Kit

ECH0214 96Tests
EUR 521.00

Anserine HBsAg ELISA Kit

EAH0214 96Tests
EUR 521.00

HbsAg ELISA KIT|Human

EF007266 96 Tests
EUR 689.00

Polyclonal Goat Anti-HBsAg

C020108-10mg 10mg
EUR 1114.00

Polyclonal Goat Anti-HBsAg

C020108-1mg 1mg
EUR 269.00

anti- HBsAg mouse antibody

HBV001 100µg
EUR 548.75
  • Immunogen: HBsAg
  • Research Area: Signal Transduction
Description: Antibody raised against HBsAg mouse

anti- HBsAg mouse antibody

HBV002 100µg
EUR 548.75
  • Immunogen: HBsAg
  • Research Area: Signal Transduction
Description: Antibody raised against HBsAg mouse

Rat HBsAg ELISA Kit

ERH0214 96Tests
EUR 521.00

Rabbit HBsAg ELISA Kit

ERTH0214 96Tests
EUR 521.00

Mouse HBsAg ELISA Kit

EMH0214 96Tests
EUR 521.00

Porcine HBsAg ELISA Kit

EPH0214 96Tests
EUR 521.00

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85.00
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85.00
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133.00

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85.00
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98.00

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286.00

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164.00

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369.00

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506.00

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95.00

Ivd ORF Vector (Mouse) (pORF)

ORF048200 1.0 ug DNA
EUR 506.00

ELISA kit for Canine hepatitis B virus surface antigen,HBsAg

EK0029 96 tests
EUR 830.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Canine hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human hepatitis B virus surface antigen,HBsAg

EK0216 96 tests
EUR 603.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Human hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse hepatitis B virus surface antigen,HBsAg

EK0341 96 tests
EUR 830.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit 

KTE63050-48T 48T
EUR 354.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit 

KTE63050-5platesof96wells 5 plates of 96 wells
EUR 2252.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit 

KTE63050-96T 96T
EUR 572.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA

20021-1 100 ug
EUR 225.00

Leave a Reply

Your email address will not be published. Required fields are marked *