C1GALT1C1 siRNA

20-abx900698
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

C1GALT1C1 siRNA

20-abx909638
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

C1GALT1C1 siRNA

20-abx909639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

C1GALT1C1 Antibody

46366-100ul 100ul
EUR 252

C1GALT1C1 antibody

70R-16072 50 ul
EUR 435
Description: Rabbit polyclonal C1GALT1C1 antibody

C1GALT1C1 Antibody

1-CSB-PA003490ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against C1GALT1C1. Recognizes C1GALT1C1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

C1GALT1C1 Antibody

1-CSB-PA003490ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against C1GALT1C1. Recognizes C1GALT1C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

C1GALT1C1 Antibody

1-CSB-PA003490GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against C1GALT1C1. Recognizes C1GALT1C1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-C1GALT1C1

YF-PA18547 50 ug
EUR 363
Description: Mouse polyclonal to C1GALT1C1

C1GALT1C1 Conjugated Antibody

C46366 100ul
EUR 397

C1GALT1C1 cloning plasmid

CSB-CL003490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atgctttctgaaagcagctcctttttgaagggtgtgatgcttggaagcattttctgtgctttgatcactatgctaggacacattaggattggtcatggaaatagaatgcaccaccatgagcatcatcacctacaagctcctaacaaagaagatatcttgaaaatttcagaggatga
  • Show more
Description: A cloning plasmid for the C1GALT1C1 gene.

C1GALT1C1 Rabbit pAb

A7590-100ul 100 ul
EUR 308

C1GALT1C1 Rabbit pAb

A7590-200ul 200 ul
EUR 459

C1GALT1C1 Rabbit pAb

A7590-20ul 20 ul
EUR 183

C1GALT1C1 Rabbit pAb

A7590-50ul 50 ul
EUR 223

pCMV-SPORT6-C1GALT1C1

PVT18958 2 ug
EUR 231

Anti-C1GALT1C1 antibody

STJ29727 100 µl
EUR 277
Description: This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.

Mouse C1GALT1C1 shRNA Plasmid

20-abx975170
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat C1GALT1C1 shRNA Plasmid

20-abx989147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

C1GALT1C1 ELISA KIT|Human

EF010395 96 Tests
EUR 689

Human C1GALT1C1 shRNA Plasmid

20-abx959169
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

C1GALT1C1 Recombinant Protein (Human)

RP004144 100 ug Ask for price

C1GALT1C1 Recombinant Protein (Rat)

RP192614 100 ug Ask for price

C1GALT1C1 Recombinant Protein (Mouse)

RP120233 100 ug Ask for price

Polyclonal C1GALT1C1 Antibody (N-Term)

APG02308G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human C1GALT1C1 (N-Term). This antibody is tested and proven to work in the following applications:

C1GALT1C1 ORF Vector (Human) (pORF)

ORF001382 1.0 ug DNA
EUR 95

C1galt1c1 ORF Vector (Mouse) (pORF)

ORF040079 1.0 ug DNA
EUR 506

C1galt1c1 ORF Vector (Rat) (pORF)

ORF064206 1.0 ug DNA
EUR 506

C1GALT1C1 sgRNA CRISPR Lentivector set (Human)

K0008201 3 x 1.0 ug
EUR 339

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

20-abx111284
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

20-abx005637
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

20-abx321007
  • EUR 342.00
  • EUR 230.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

20-abx322490
  • EUR 342.00
  • EUR 230.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1C1 sgRNA CRISPR Lentivector set (Mouse)

K3003901 3 x 1.0 ug
EUR 339

C1galt1c1 sgRNA CRISPR Lentivector set (Rat)

K7145701 3 x 1.0 ug
EUR 339

C1GALT1C1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0008202 1.0 ug DNA
EUR 154

C1GALT1C1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0008203 1.0 ug DNA
EUR 154

C1GALT1C1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0008204 1.0 ug DNA
EUR 154

C1GALT1C1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3003902 1.0 ug DNA
EUR 154

C1GALT1C1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3003903 1.0 ug DNA
EUR 154

C1GALT1C1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3003904 1.0 ug DNA
EUR 154

C1galt1c1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7145702 1.0 ug DNA
EUR 154

C1galt1c1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7145703 1.0 ug DNA
EUR 154

C1galt1c1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7145704 1.0 ug DNA
EUR 154

C1GALT1C1 Protein Vector (Human) (pPB-C-His)

PV005525 500 ng
EUR 329

C1GALT1C1 Protein Vector (Human) (pPB-N-His)

PV005526 500 ng
EUR 329

C1GALT1C1 Protein Vector (Human) (pPM-C-HA)

PV005527 500 ng
EUR 329

C1GALT1C1 Protein Vector (Human) (pPM-C-His)

PV005528 500 ng
EUR 329

C1GALT1C1 Protein Vector (Human) (pPB-His-MBP)

PV329758 500 ng
EUR 329

C1GALT1C1 Protein Vector (Human) (pPB-His-GST)

PV329759 500 ng
EUR 329

C1GALT1C1 Protein Vector (Rat) (pPB-C-His)

PV256822 500 ng
EUR 603

C1GALT1C1 Protein Vector (Rat) (pPB-N-His)

PV256823 500 ng
EUR 603

C1GALT1C1 Protein Vector (Rat) (pPM-C-HA)

PV256824 500 ng
EUR 603

C1GALT1C1 Protein Vector (Rat) (pPM-C-His)

PV256825 500 ng
EUR 603

C1GALT1C1 Protein Vector (Mouse) (pPB-C-His)

PV160314 500 ng
EUR 603

C1GALT1C1 Protein Vector (Mouse) (pPB-N-His)

PV160315 500 ng
EUR 603

C1GALT1C1 Protein Vector (Mouse) (pPM-C-HA)

PV160316 500 ng
EUR 603

C1GALT1C1 Protein Vector (Mouse) (pPM-C-His)

PV160317 500 ng
EUR 603

C1galt1c1 3'UTR Luciferase Stable Cell Line

TU201487 1.0 ml Ask for price

C1galt1c1 3'UTR GFP Stable Cell Line

TU152929 1.0 ml Ask for price

C1GALT1C1 3'UTR Luciferase Stable Cell Line

TU002001 1.0 ml
EUR 1394

C1galt1c1 3'UTR Luciferase Stable Cell Line

TU102929 1.0 ml Ask for price

C1GALT1C1 3'UTR GFP Stable Cell Line

TU052001 1.0 ml
EUR 1394

C1galt1c1 3'UTR GFP Stable Cell Line

TU251487 1.0 ml Ask for price

Goat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E06C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E06C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E06C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E02C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E02C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E02C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E03C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E03C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E03C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E04C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E04C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E04C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E01C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E01C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E01C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E07C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E07C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E07C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E08C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E08C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E08C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E09C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E09C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E09C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine C1GALT1- specific chaperone 1, C1GALT1C1 ELISA KIT

ELI-11000b 96 Tests
EUR 928

Human C1GALT1- specific chaperone 1, C1GALT1C1 ELISA KIT

ELI-11072h 96 Tests
EUR 824