GZMH

Human Granzyme H (GZMH) ELISA Kit
DL-GZMH-Hu-48	DLdevelop	1 kit of 48 tests	EUR 517.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Granzyme H (GZMH)

Human Granzyme H (GZMH) ELISA Kit
DL-GZMH-Hu-96	DLdevelop	1 kit of 96 tests	EUR 695.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Granzyme H (GZMH)

Human Granzyme H (GZMH) ELISA Kit
DLR-GZMH-Hu-48T	DL Develop	48T	EUR 554.00
Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
DLR-GZMH-Hu-96T	DL Develop	96T	EUR 725.00
Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
RDR-GZMH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589.00

Human Granzyme H (GZMH) ELISA Kit
RDR-GZMH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820.00

Human Granzyme H (GZMH) ELISA Kit
RD-GZMH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563.00

Human Granzyme H (GZMH) ELISA Kit
RD-GZMH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783.00

GZMH Antibody
1-CSB-PA010083ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GZMH Antibody
1-CSB-PA009078	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

GZMH Antibody
43676-100ul	SAB	100ul	EUR 252.00

GZMH siRNA
20-abx918991	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GZMH Antibody
CSB-PA966723-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

GZMH Antibody
CSB-PA966723-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

anti-GZMH
YF-PA12223	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to GZMH

anti-GZMH
YF-PA12224	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to GZMH

anti-GZMH
YF-PA12225	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to GZMH

anti-GZMH
YF-PA12226	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to GZMH

GZMH Conjugated Antibody
C43676	SAB	100ul	EUR 397.00

GZMH cloning plasmid
CSB-CL010083HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 741 Sequence: atgcagccattcctcctcctgttggcctttcttctgacccctggggctgggacagaggagatcatcgggggccatgaggccaagccccactcccgcccctacatggcctttgttcagtttctgcaagagaagagtcggaagaggtgtggcggcatcctagtgagaaaggactttgt Show more
Description: A cloning plasmid for the GZMH gene.

GZMB/GZMH Antibody
1-CSB-PA009072	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMB/GZMH. Recognizes GZMB/GZMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GZMH Rabbit pAb
A6154-100ul	Abclonal	100 ul	EUR 308.00

GZMH Rabbit pAb
A6154-200ul	Abclonal	200 ul	EUR 459.00

GZMH Rabbit pAb
A6154-20ul	Abclonal	20 ul	EUR 183.00

GZMH Rabbit pAb
A6154-50ul	Abclonal	50 ul	EUR 223.00

GZMB / GZMH Antibody
20-abx329145	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-GZMH antibody
STJ27907	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14.

Granzyme H (GZMH) Antibody
20-abx121409	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx129052	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme H (GZMH) Antibody
20-abx014027	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx006320	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
abx340196-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
abx330513-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx320687	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx215786	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx324910	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx172669	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Human GZMH shRNA Plasmid
20-abx952034	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GZMH protein (His tag)
80R-4173	Fitzgerald	20 ug	EUR 327.00
Description: Recombinant Human GZMH protein (His tag)

GZMH Recombinant Protein (Human)
RP014308	ABM	100 ug	Ask for price

pCMV-SPORT6-GZMH Plasmid
PVT16410	Lifescience Market	2 ug	EUR 325.00

Recombinant Granzyme H (GZMH)
4-RPL575Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20718 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.2kDa Isoelectric Point: 9.9
Description: Recombinant Human Granzyme H expressed in: E.coli

Human Granzyme H (GZMH) Protein
20-abx166692	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Polyclonal GZMH Antibody (N-Term)
APR04873G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMH (N-Term). This antibody is tested and proven to work in the following applications:

GZMH ORF Vector (Human) (pORF)
ORF004770	ABM	1.0 ug DNA	EUR 95.00

Human Granzyme H (GZMH) ELISA Kit
20-abx151731	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granzyme H (GZMH) CLIA Kit
20-abx495943	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Granzyme H, GZMH ELISA KIT
ELI-27896h	Lifescience Market	96 Tests	EUR 824.00

GZMH sgRNA CRISPR Lentivector set (Human)
K0924001	ABM	3 x 1.0 ug	EUR 339.00

Granzyme H (GZMH) Polyclonal Antibody (Human)
4-PAL575Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMH (Glu19~Leu246) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Granzyme H (GZMH)

GZMH Granzyme-H Human Recombinant Protein
PROTP20718	BosterBio	Regular: 10ug	EUR 317.00
Description: GZMH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 248 amino acids (20-246 a.a) and having a molecular mass of 27.5kDa.;GZMH is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Granzyme H ELISA Kit (GZMH)
RK01529	Abclonal	96 Tests	EUR 521.00

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.90
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
4-SEL575Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Granzyme H elisa. Alternative names of the recognized antigen: CCP-X CGL-2 CSP-C CTLA1 CTSGL2 Cathepsin G-Like 2, Protein h-CCPX Cytotoxic T-lymphocyte proteinase Cytotoxic serine protease C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme H (GZMH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human GZMH (Granzyme H)
ELK6670	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme H (GZMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme H (GZMH Show more
Description: A sandwich ELISA kit for detection of Granzyme H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GZMH sgRNA CRISPR Lentivector (Human) (Target 1)
K0924002	ABM	1.0 ug DNA	EUR 154.00

GZMH sgRNA CRISPR Lentivector (Human) (Target 2)
K0924003	ABM	1.0 ug DNA	EUR 154.00