GZMH

Human Granzyme H (GZMH) ELISA Kit

DL-GZMH-Hu-48 1 kit of 48 tests
EUR 517.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Granzyme H (GZMH)

Human Granzyme H (GZMH) ELISA Kit

DL-GZMH-Hu-96 1 kit of 96 tests
EUR 695.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Granzyme H (GZMH)

Human Granzyme H (GZMH) ELISA Kit

DLR-GZMH-Hu-48T 48T
EUR 554.00
  • Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

DLR-GZMH-Hu-96T 96T
EUR 725.00
  • Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

RDR-GZMH-Hu-48Tests 48 Tests
EUR 589.00

Human Granzyme H (GZMH) ELISA Kit

RDR-GZMH-Hu-96Tests 96 Tests
EUR 820.00

Human Granzyme H (GZMH) ELISA Kit

RD-GZMH-Hu-48Tests 48 Tests
EUR 563.00

Human Granzyme H (GZMH) ELISA Kit

RD-GZMH-Hu-96Tests 96 Tests
EUR 783.00

GZMH Antibody

1-CSB-PA010083ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GZMH Antibody

1-CSB-PA009078
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

GZMH Antibody

43676-100ul 100ul
EUR 252.00

GZMH siRNA

20-abx918991
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GZMH Antibody

CSB-PA966723-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

GZMH Antibody

CSB-PA966723-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

anti-GZMH

YF-PA12223 50 ul
EUR 363.00
Description: Mouse polyclonal to GZMH

anti-GZMH

YF-PA12224 50 ug
EUR 363.00
Description: Mouse polyclonal to GZMH

anti-GZMH

YF-PA12225 50 ul
EUR 363.00
Description: Mouse polyclonal to GZMH

anti-GZMH

YF-PA12226 50 ug
EUR 363.00
Description: Mouse polyclonal to GZMH

GZMH Conjugated Antibody

C43676 100ul
EUR 397.00

GZMH cloning plasmid

CSB-CL010083HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgcagccattcctcctcctgttggcctttcttctgacccctggggctgggacagaggagatcatcgggggccatgaggccaagccccactcccgcccctacatggcctttgttcagtttctgcaagagaagagtcggaagaggtgtggcggcatcctagtgagaaaggactttgt
  • Show more
Description: A cloning plasmid for the GZMH gene.

GZMB/GZMH Antibody

1-CSB-PA009072
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMB/GZMH. Recognizes GZMB/GZMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GZMH Rabbit pAb

A6154-100ul 100 ul
EUR 308.00

GZMH Rabbit pAb

A6154-200ul 200 ul
EUR 459.00

GZMH Rabbit pAb

A6154-20ul 20 ul
EUR 183.00

GZMH Rabbit pAb

A6154-50ul 50 ul
EUR 223.00

GZMB / GZMH Antibody

20-abx329145
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-GZMH antibody

STJ27907 100 µl
EUR 277.00
Description: This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14.

Granzyme H (GZMH) Antibody

20-abx121409
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

20-abx129052
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme H (GZMH) Antibody

20-abx014027
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

20-abx006320
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

abx340196-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

abx330513-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

20-abx320687
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

20-abx215786
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

20-abx324910
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody

20-abx172669
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human GZMH shRNA Plasmid

20-abx952034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GZMH protein (His tag)

80R-4173 20 ug
EUR 327.00
Description: Recombinant Human GZMH protein (His tag)

GZMH Recombinant Protein (Human)

RP014308 100 ug Ask for price

pCMV-SPORT6-GZMH Plasmid

PVT16410 2 ug
EUR 325.00

Recombinant Granzyme H (GZMH)

4-RPL575Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20718
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: 9.9
Description: Recombinant Human Granzyme H expressed in: E.coli

Human Granzyme H (GZMH) Protein

20-abx166692
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polyclonal GZMH Antibody (N-Term)

APR04873G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMH (N-Term). This antibody is tested and proven to work in the following applications:

GZMH ORF Vector (Human) (pORF)

ORF004770 1.0 ug DNA
EUR 95.00

Human Granzyme H (GZMH) ELISA Kit

20-abx151731
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme H (GZMH) CLIA Kit

20-abx495943
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Granzyme H, GZMH ELISA KIT

ELI-27896h 96 Tests
EUR 824.00

GZMH sgRNA CRISPR Lentivector set (Human)

K0924001 3 x 1.0 ug
EUR 339.00

Granzyme H (GZMH) Polyclonal Antibody (Human)

4-PAL575Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMH (Glu19~Leu246)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Granzyme H (GZMH)

GZMH Granzyme-H Human Recombinant Protein

PROTP20718 Regular: 10ug
EUR 317.00
Description: GZMH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 248 amino acids (20-246 a.a) and having a molecular mass of 27.5kDa.;GZMH is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Granzyme H ELISA Kit (GZMH)

RK01529 96 Tests
EUR 521.00

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.90
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

4-SEL575Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme H elisa. Alternative names of the recognized antigen: CCP-X
  • CGL-2
  • CSP-C
  • CTLA1
  • CTSGL2
  • Cathepsin G-Like 2, Protein h-CCPX
  • Cytotoxic T-lymphocyte proteinase
  • Cytotoxic serine protease C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme H (GZMH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human GZMH (Granzyme H)

ELK6670 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme H (GZMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme H (GZMH
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GZMH sgRNA CRISPR Lentivector (Human) (Target 1)

K0924002 1.0 ug DNA
EUR 154.00

GZMH sgRNA CRISPR Lentivector (Human) (Target 2)

K0924003 1.0 ug DNA
EUR 154.00