Human Granzyme H (GZMH) ELISA Kit
DLR-GZMH-Hu-96T 96T
EUR 725
  • Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
RDR-GZMH-Hu-48Tests 48 Tests
EUR 589

Human Granzyme H (GZMH) ELISA Kit
RDR-GZMH-Hu-96Tests 96 Tests
EUR 820

Human Granzyme H (GZMH) ELISA Kit
RD-GZMH-Hu-48Tests 48 Tests
EUR 563

Human Granzyme H (GZMH) ELISA Kit
RD-GZMH-Hu-96Tests 96 Tests
EUR 783

GZMH Antibody
43676-100ul 100ul
EUR 252

GZMH Antibody
CSB-PA966723-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

GZMH Antibody
CSB-PA966723-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

GZMH Antibody
1-CSB-PA009078
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

GZMH Antibody
1-CSB-PA010083ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GZMH. Recognizes GZMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GZMH siRNA
20-abx918991
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GZMH
YF-PA12223 50 ul
EUR 363
Description: Mouse polyclonal to GZMH

anti-GZMH
YF-PA12224 50 ug
EUR 363
Description: Mouse polyclonal to GZMH

anti-GZMH
YF-PA12225 50 ul
EUR 363
Description: Mouse polyclonal to GZMH

anti-GZMH
YF-PA12226 50 ug
EUR 363
Description: Mouse polyclonal to GZMH

GZMH Conjugated Antibody
C43676 100ul
EUR 397

GZMB/GZMH Antibody
1-CSB-PA009072
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMB/GZMH. Recognizes GZMB/GZMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GZMB / GZMH Antibody
20-abx329145
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GZMH cloning plasmid
CSB-CL010083HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgcagccattcctcctcctgttggcctttcttctgacccctggggctgggacagaggagatcatcgggggccatgaggccaagccccactcccgcccctacatggcctttgttcagtttctgcaagagaagagtcggaagaggtgtggcggcatcctagtgagaaaggactttgt
  • Show more
Description: A cloning plasmid for the GZMH gene.

GZMH Rabbit pAb
A6154-100ul 100 ul
EUR 308

GZMH Rabbit pAb
A6154-200ul 200 ul
EUR 459

GZMH Rabbit pAb
A6154-20ul 20 ul
EUR 183

GZMH Rabbit pAb
A6154-50ul 50 ul
EUR 223

Anti-GZMH antibody
STJ27907 100 µl
EUR 277
Description: This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14.

GZMH protein (His tag)
80R-4173 20 ug
EUR 327
Description: Recombinant Human GZMH protein (His tag)

Granzyme H (GZMH) Antibody
20-abx006320
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx215786
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx121409
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx129052
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme H (GZMH) Antibody
20-abx172669
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme H (GZMH) Antibody
20-abx014027
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
abx340196-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx320687
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
abx330513-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Granzyme H (GZMH) Antibody
20-abx324910
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human GZMH shRNA Plasmid
20-abx952034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Granzyme H (GZMH)
4-RPL575Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20718
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: 9.9
Description: Recombinant Human Granzyme H expressed in: E.coli

pCMV-SPORT6-GZMH Plasmid
PVT16410 2 ug
EUR 325

GZMH Recombinant Protein (Human)
RP014308 100 ug Ask for price

Polyclonal GZMH Antibody (N-Term)
APR04873G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMH (N-Term). This antibody is tested and proven to work in the following applications:

Human Granzyme H (GZMH) Protein
20-abx166692
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GZMH ORF Vector (Human) (pORF)
ORF004770 1.0 ug DNA
EUR 95

GZMH ELISA Kit (Human) (OKCD00727)
OKCD00727 96 Wells
EUR 909
Description: Description of target: Cytotoxic chymotrypsin-like serine protease with preference for bulky and aromatic residues at the P1 position and acidic residues at the P3' and P4' sites. Probably necessary for target cell lysis in cell-mediated immune responses. Participates in the antiviral response via direct cleavage of several proteins essential for viral replication.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Structural insights into the substrate specificity of human granzyme H: the functional roles of a novel RKR motif."_x005F_x005F_x000D_Wang L., Zhang K., Wu L., Liu S., Zhang H., Zhou Q., Tong L., Sun F., Fan Z._x005F_x005F_x000D_J. Immunol. 188:765-773(2012) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.2 ANGSTROMS) OF 21-246 OF MUTANT ASN-102 ALONE AND IN COMPLEX WITH SUBSTRATE PEPTIDE AND INHIBITOR, FUNCTION, SUBSTRATE SPECIFICITY, DISULFIDE BONDS.Ref.9"Identification of SERPINB1 as a physiological inhibitor of human granzyme H."_x005F_x005F_x000D_Wang L., Li Q., Wu L., Liu S., Zhang Y., Yang X., Zhu P., Zhang H., Zhang K., Lou J., Liu P., Tong L., Sun F., Fan Z._x005F_x005F_x000D_J. Immunol. 190:1319-1330(2013) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (3.0 ANGSTROMS) OF 21-246 IN COMPLEX WITH SERPINB1, FUNCTION, DISULFIDE BONDS, TISSUE SPECIFICITY, ENZYME REGULATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 pg/mL

Human Granzyme H (GZMH) ELISA Kit
20-abx151731
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme H, GZMH ELISA KIT
ELI-27896h 96 Tests
EUR 824

Human Granzyme H (GZMH) CLIA Kit
20-abx495943
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

GZMH sgRNA CRISPR Lentivector set (Human)
K0924001 3 x 1.0 ug
EUR 339

Granzyme H (GZMH) Polyclonal Antibody (Human)
4-PAL575Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMH (Glu19~Leu246)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Granzyme H (GZMH)

GZMH Granzyme-H Human Recombinant Protein
PROTP20718 Regular: 10ug
EUR 317
Description: GZMH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 248 amino acids (20-246 a.a) and having a molecular mass of 27.5kDa.;GZMH is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Granzyme H ELISA Kit (GZMH)
RK01529 96 Tests
EUR 521

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
SEL575Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit
4-SEL575Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme H elisa. Alternative names of the recognized antigen: CCP-X
  • CGL-2
  • CSP-C
  • CTLA1
  • CTSGL2
  • Cathepsin G-Like 2, Protein h-CCPX
  • Cytotoxic T-lymphocyte proteinase
  • Cytotoxic serine protease C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme H (GZMH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human GZMH (Granzyme H)
ELK6670 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme H (GZMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme H (GZMH
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GZMH sgRNA CRISPR Lentivector (Human) (Target 1)
K0924002 1.0 ug DNA
EUR 154

GZMH sgRNA CRISPR Lentivector (Human) (Target 2)
K0924003 1.0 ug DNA
EUR 154

GZMH sgRNA CRISPR Lentivector (Human) (Target 3)
K0924004 1.0 ug DNA
EUR 154

Granzyme H (GZMH) Polyclonal Antibody (Human), APC
4-PAL575Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMH (Glu19~Leu246)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Granzyme H (GZMH). This antibody is labeled with APC.