SLC25A14

SLC25A14 siRNA
20-abx933687	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLC25A14 antibody
70R-1750	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal SLC25A14 antibody

SLC25A14 Antibody
ABD9283	Lifescience Market	100 ug	EUR 438.00

SLC25A14 Antibody
45812-100ul	SAB	100ul	EUR 252.00

SLC25A14 Antibody
45812-50ul	SAB	50ul	EUR 187.00

SLC25A14 Antibody
1-CSB-PA021480LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

SLC25A14 Antibody
DF9283	Affbiotech	200ul	EUR 304.00
Description: SLC25A14 Antibody detects endogenous levels of total SLC25A14.

SLC25A14 Antibody (HRP)
20-abx305331	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC25A14 Antibody (FITC)
20-abx305332	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC25A14 Antibody (Biotin)
20-abx305333	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC25A14 Polyclonal Antibody
A63430	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SLC25A14 Rabbit pAb
A13731-100ul	Abclonal	100 ul	EUR 308.00

SLC25A14 Rabbit pAb
A13731-200ul	Abclonal	200 ul	EUR 459.00

SLC25A14 Rabbit pAb
A13731-20ul	Abclonal	20 ul	EUR 183.00

SLC25A14 Rabbit pAb
A13731-50ul	Abclonal	50 ul	EUR 223.00

SLC25A14 Blocking Peptide
DF9283-BP	Affbiotech	1mg	EUR 195.00

SLC25A14 Conjugated Antibody
C45812	SAB	100ul	EUR 397.00

SLC25A14 Blocking Peptide
33R-8540	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A14 antibody, catalog no. 70R-1750

SLC25A14 cloning plasmid
CSB-CL021480HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 978 Sequence: ATGGGTATCTTTCCCGGAATAATCCTAATTTTTCTAAGGGTGAAGTTTGCAACGGCGGCCGTGATTGTAAGCGGACACCAGAAAAGTACCACTGTAAGTCATGAGATGTCTGGTCTGAATTGGAAACCCTTTGTATATGGCGGCCTTGCCTCTATCGTGGCTGAGTTTGGGACTTT Show more
Description: A cloning plasmid for the SLC25A14 gene.

Anti-SLC25A14 antibody
STJ115684	St John's Laboratory	100 µl	EUR 277.00
Description: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4.

Anti-SLC25A14 (1C12)
YF-MA20239	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to SLC25A14

Human SLC25A14 shRNA Plasmid
20-abx955945	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SLC25A14 shRNA Plasmid
20-abx972747	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SLC25A14 Antibody, FITC conjugated
1-CSB-PA021480LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC25A14 Antibody, HRP conjugated
1-CSB-PA021480LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC25A14 Antibody, Biotin conjugated
1-CSB-PA021480LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SLC25A14 Recombinant Protein (Rat)
RP229175	ABM	100 ug	Ask for price

SLC25A14 Recombinant Protein (Human)
RP043408	ABM	100 ug	Ask for price

SLC25A14 Recombinant Protein (Mouse)
RP172586	ABM	100 ug	Ask for price

SLC25A14 Recombinant Protein (Mouse)
RP172589	ABM	100 ug	Ask for price

SLC25A14 Polyclonal Antibody, HRP Conjugated
A63431	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SLC25A14 Polyclonal Antibody, FITC Conjugated
A63432	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SLC25A14 Polyclonal Antibody, Biotin Conjugated
A63433	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SLC25A14 ORF Vector (Human) (pORF)
ORF014470	ABM	1.0 ug DNA	EUR 354.00

Slc25a14 ORF Vector (Mouse) (pORF)
ORF057530	ABM	1.0 ug DNA	EUR 506.00

Slc25a14 ORF Vector (Mouse) (pORF)
ORF057531	ABM	1.0 ug DNA	EUR 506.00

Slc25a14 ORF Vector (Rat) (pORF)
ORF076393	ABM	1.0 ug DNA	EUR 506.00

SLC25A14 sgRNA CRISPR Lentivector set (Human)
K2177501	ABM	3 x 1.0 ug	EUR 339.00

Slc25a14 sgRNA CRISPR Lentivector set (Mouse)
K4535101	ABM	3 x 1.0 ug	EUR 339.00

Slc25a14 sgRNA CRISPR Lentivector set (Rat)
K6978101	ABM	3 x 1.0 ug	EUR 339.00

Brain Mitochondrial Carrier Protein 1 (SLC25A14) Antibody
20-abx301956	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Brain Mitochondrial Carrier Protein 1 (SLC25A14) Antibody
20-abx218618	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

SLC25A14 Protein Vector (Human) (pPB-C-His)
PV057877	ABM	500 ng	EUR 481.00

SLC25A14 Protein Vector (Human) (pPB-N-His)
PV057878	ABM	500 ng	EUR 481.00

SLC25A14 Protein Vector (Human) (pPM-C-HA)
PV057879	ABM	500 ng	EUR 481.00

SLC25A14 Protein Vector (Human) (pPM-C-His)
PV057880	ABM	500 ng	EUR 481.00

SLC25A14 sgRNA CRISPR Lentivector (Human) (Target 1)
K2177502	ABM	1.0 ug DNA	EUR 154.00

SLC25A14 sgRNA CRISPR Lentivector (Human) (Target 2)
K2177503	ABM	1.0 ug DNA	EUR 154.00

SLC25A14 sgRNA CRISPR Lentivector (Human) (Target 3)
K2177504	ABM	1.0 ug DNA	EUR 154.00

Slc25a14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4535102	ABM	1.0 ug DNA	EUR 154.00

Slc25a14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4535103	ABM	1.0 ug DNA	EUR 154.00

Slc25a14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4535104	ABM	1.0 ug DNA	EUR 154.00

Slc25a14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6978102	ABM	1.0 ug DNA	EUR 154.00

Slc25a14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6978103	ABM	1.0 ug DNA	EUR 154.00

Slc25a14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6978104	ABM	1.0 ug DNA	EUR 154.00

SLC25A14 3'UTR Luciferase Stable Cell Line
TU023490	ABM	1.0 ml	EUR 1394.00

SLC25A14 Protein Vector (Rat) (pPB-C-His)
PV305570	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Rat) (pPB-N-His)
PV305571	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Rat) (pPM-C-HA)
PV305572	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Rat) (pPM-C-His)
PV305573	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPB-C-His)
PV230118	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPB-N-His)
PV230119	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPM-C-HA)
PV230120	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPM-C-His)
PV230121	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPB-C-His)
PV230122	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPB-N-His)
PV230123	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPM-C-HA)
PV230124	ABM	500 ng	EUR 603.00

SLC25A14 Protein Vector (Mouse) (pPM-C-His)
PV230125	ABM	500 ng	EUR 603.00

SLC25A14 3'UTR GFP Stable Cell Line
TU073490	ABM	1.0 ml	EUR 1394.00

Slc25a14 3'UTR Luciferase Stable Cell Line
TU220518	ABM	1.0 ml	Ask for price

Slc25a14 3'UTR GFP Stable Cell Line
TU270518	ABM	1.0 ml	Ask for price

Slc25a14 3'UTR GFP Stable Cell Line
TU168991	ABM	1.0 ml	Ask for price

Slc25a14 3'UTR Luciferase Stable Cell Line
TU118991	ABM	1.0 ml	Ask for price

SLC25A14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV648373	ABM	1.0 ug DNA	EUR 514.00

SLC25A14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV648377	ABM	1.0 ug DNA	EUR 514.00

SLC25A14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV648378	ABM	1.0 ug DNA	EUR 514.00

Human Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E01B0967-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E01B0967-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E01B0967-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E02B0967-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E02B0967-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E02B0967-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E06B0967-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E06B0967-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E06B0967-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.