SLC25A14

SLC25A14 Antibody
45812-100ul 100ul
EUR 252
SLC25A14 Antibody
45812-50ul 50ul
EUR 187
SLC25A14 Antibody
DF9283 200ul
EUR 304
Description: SLC25A14 Antibody detects endogenous levels of total SLC25A14.
SLC25A14 Antibody
1-CSB-PA021480LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
SLC25A14 siRNA
20-abx933686
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A14 siRNA
20-abx933687
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A14 Antibody
ABD9283 100 ug
EUR 438
SLC25A14 Rabbit pAb
A13731-100ul 100 ul
EUR 308
SLC25A14 Rabbit pAb
A13731-200ul 200 ul
EUR 459
SLC25A14 Rabbit pAb
A13731-20ul 20 ul
EUR 183
SLC25A14 Rabbit pAb
A13731-50ul 50 ul
EUR 223
SLC25A14 Blocking Peptide
33R-8540 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A14 antibody, catalog no. 70R-1750
SLC25A14 Blocking Peptide
DF9283-BP 1mg
EUR 195
SLC25A14 Conjugated Antibody
C45812 100ul
EUR 397
SLC25A14 Antibody (HRP)
20-abx305331
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A14 Antibody (FITC)
20-abx305332
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A14 Antibody (Biotin)
20-abx305333
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A14 cloning plasmid
CSB-CL021480HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 978
  • Sequence: ATGGGTATCTTTCCCGGAATAATCCTAATTTTTCTAAGGGTGAAGTTTGCAACGGCGGCCGTGATTGTAAGCGGACACCAGAAAAGTACCACTGTAAGTCATGAGATGTCTGGTCTGAATTGGAAACCCTTTGTATATGGCGGCCTTGCCTCTATCGTGGCTGAGTTTGGGACTTT
  • Show more
Description: A cloning plasmid for the SLC25A14 gene.
SLC25A14 Polyclonal Antibody
A63430 100 µg
EUR 570.55
Description: The best epigenetics products
Anti-SLC25A14 antibody
STJ115684 100 µl
EUR 277
Description: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4.
Anti-SLC25A14 (1C12)
YF-MA20239 100 ug
EUR 363
Description: Mouse monoclonal to SLC25A14
Mouse SLC25A14 shRNA Plasmid
20-abx972747
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC25A14 Antibody, HRP conjugated
1-CSB-PA021480LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC25A14 Antibody, FITC conjugated
1-CSB-PA021480LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC25A14 Antibody, Biotin conjugated
1-CSB-PA021480LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A14. Recognizes SLC25A14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SLC25A14 shRNA Plasmid
20-abx955945
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC25A14 Recombinant Protein (Human)
RP043408 100 ug Ask for price
SLC25A14 Recombinant Protein (Rat)
RP229175 100 ug Ask for price
SLC25A14 Recombinant Protein (Mouse)
RP172586 100 ug Ask for price
SLC25A14 Recombinant Protein (Mouse)
RP172589 100 ug Ask for price
SLC25A14 Polyclonal Antibody, HRP Conjugated
A63431 100 µg
EUR 570.55
Description: kits suitable for this type of research
SLC25A14 Polyclonal Antibody, FITC Conjugated
A63432 100 µg
EUR 570.55
Description: fast delivery possible
SLC25A14 Polyclonal Antibody, Biotin Conjugated
A63433 100 µg
EUR 570.55
Description: reagents widely cited
Slc25a14 ORF Vector (Rat) (pORF)
ORF076393 1.0 ug DNA
EUR 506
SLC25A14 ORF Vector (Human) (pORF)
ORF014470 1.0 ug DNA
EUR 354
Slc25a14 ORF Vector (Mouse) (pORF)
ORF057530 1.0 ug DNA
EUR 506
Slc25a14 ORF Vector (Mouse) (pORF)
ORF057531 1.0 ug DNA
EUR 506
Slc25a14 sgRNA CRISPR Lentivector set (Rat)
K6978101 3 x 1.0 ug
EUR 339
SLC25A14 sgRNA CRISPR Lentivector set (Human)
K2177501 3 x 1.0 ug
EUR 339
Slc25a14 sgRNA CRISPR Lentivector set (Mouse)
K4535101 3 x 1.0 ug
EUR 339
Brain Mitochondrial Carrier Protein 1 (SLC25A14) Antibody
20-abx218618
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Brain Mitochondrial Carrier Protein 1 (SLC25A14) Antibody
20-abx301956
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Slc25a14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6978102 1.0 ug DNA
EUR 154
Slc25a14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6978103 1.0 ug DNA
EUR 154
Slc25a14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6978104 1.0 ug DNA
EUR 154
SLC25A14 sgRNA CRISPR Lentivector (Human) (Target 1)
K2177502 1.0 ug DNA
EUR 154
SLC25A14 sgRNA CRISPR Lentivector (Human) (Target 2)
K2177503 1.0 ug DNA
EUR 154
SLC25A14 sgRNA CRISPR Lentivector (Human) (Target 3)
K2177504 1.0 ug DNA
EUR 154
Slc25a14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4535102 1.0 ug DNA
EUR 154
Slc25a14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4535103 1.0 ug DNA
EUR 154
Slc25a14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4535104 1.0 ug DNA
EUR 154
SLC25A14 Protein Vector (Rat) (pPB-C-His)
PV305570 500 ng
EUR 603
SLC25A14 Protein Vector (Rat) (pPB-N-His)
PV305571 500 ng
EUR 603
SLC25A14 Protein Vector (Rat) (pPM-C-HA)
PV305572 500 ng
EUR 603
SLC25A14 Protein Vector (Rat) (pPM-C-His)
PV305573 500 ng
EUR 603
SLC25A14 Protein Vector (Human) (pPB-C-His)
PV057877 500 ng
EUR 481
SLC25A14 Protein Vector (Human) (pPB-N-His)
PV057878 500 ng
EUR 481
SLC25A14 Protein Vector (Human) (pPM-C-HA)
PV057879 500 ng
EUR 481
SLC25A14 Protein Vector (Human) (pPM-C-His)
PV057880 500 ng
EUR 481
SLC25A14 Protein Vector (Mouse) (pPB-C-His)
PV230118 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPB-N-His)
PV230119 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPM-C-HA)
PV230120 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPM-C-His)
PV230121 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPB-C-His)
PV230122 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPB-N-His)
PV230123 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPM-C-HA)
PV230124 500 ng
EUR 603
SLC25A14 Protein Vector (Mouse) (pPM-C-His)
PV230125 500 ng
EUR 603
Slc25a14 3'UTR Luciferase Stable Cell Line
TU118991 1.0 ml Ask for price
Slc25a14 3'UTR GFP Stable Cell Line
TU168991 1.0 ml Ask for price
Slc25a14 3'UTR Luciferase Stable Cell Line
TU220518 1.0 ml Ask for price
Slc25a14 3'UTR GFP Stable Cell Line
TU270518 1.0 ml Ask for price
SLC25A14 3'UTR GFP Stable Cell Line
TU073490 1.0 ml
EUR 1394
SLC25A14 3'UTR Luciferase Stable Cell Line
TU023490 1.0 ml
EUR 1394
SLC25A14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV648373 1.0 ug DNA
EUR 514
SLC25A14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV648377 1.0 ug DNA
EUR 514
SLC25A14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV648378 1.0 ug DNA
EUR 514
Human Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E01B0967-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E01B0967-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E01B0967-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E03B0967-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E03B0967-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E03B0967-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E06B0967-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E06B0967-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Brain mitochondrial carrier protein 1(SLC25A14) ELISA kit
E06B0967-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Brain mitochondrial carrier protein 1(SLC25A14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.