Gemini Genomics

Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
DLR-SLC30A6-Hu-96T	DL Develop	96T	EUR 673.00
Should the Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Solute Carrier Family 30, Member 6 (SLC30A6) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
DLR-SLC30A6-Mu-48T	DL Develop	48T	EUR 527.00
Should the Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Solute Carrier Family 30, Member 6 (SLC30A6) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
DLR-SLC30A6-Mu-96T	DL Develop	96T	EUR 688.00
Should the Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Solute Carrier Family 30, Member 6 (SLC30A6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533.00

Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740.00

Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774.00

SLC30A6 antibody
70R-20341	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal SLC30A6 antibody

SLC30A6 Antibody
47462-100ul	SAB	100ul	EUR 252.00

SLC30A6 Antibody
1-CSB-PA744010LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

SLC30A6 Antibody
1-CSB-PA021571GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SLC30A6 siRNA
20-abx933852	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SLC30A6 siRNA
20-abx933853	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SLC30A6 Rabbit pAb
A11644-100ul	Abclonal	100 ul	EUR 308.00

SLC30A6 Rabbit pAb
A11644-200ul	Abclonal	200 ul	EUR 459.00

SLC30A6 Rabbit pAb
A11644-20ul	Abclonal	20 ul	EUR 183.00

SLC30A6 Rabbit pAb
A11644-50ul	Abclonal	50 ul	EUR 223.00

SLC30A6 Conjugated Antibody
C47462	SAB	100ul	EUR 397.00

SLC30A6 cloning plasmid
CSB-CL744010HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 651 Sequence: atgagtgtgtacagtgggaaagtcttactccagacaacaccaccccatgttattggtcagttggacaaactcatcagagaggtatctaccttagatggagttttagaagtccgaaatgaacatttttggaccctaggttttggctcattggctggatcagtgcatgtaagaattcg Show more
Description: A cloning plasmid for the SLC30A6 gene.

SLC30A6 Polyclonal Antibody
A65430	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

anti- SLC30A6 antibody
FNab07950	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:200-1:2000 Immunogen: solute carrier family 30(zinc transporter), member 6 Uniprot ID: Q6NXT4 Gene ID: 55676 Research Area: Signal Transduction
Description: Antibody raised against SLC30A6

Anti-SLC30A6 antibody
PAab07950	Lifescience Market	100 ug	EUR 412.00

Anti-SLC30A6 antibody
STJ113247	St John's Laboratory	100 µl	EUR 277.00

SLC30A6 Antibody, HRP conjugated
1-CSB-PA744010LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC30A6 Antibody, FITC conjugated
1-CSB-PA744010LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC30A6 Antibody, Biotin conjugated
1-CSB-PA744010LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SLC30A6 ELISA KIT|Human
EF002999	Lifescience Market	96 Tests	EUR 689.00

Human SLC30A6 shRNA Plasmid
20-abx960824	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse SLC30A6 shRNA Plasmid
20-abx980652	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

SLC30A6 Recombinant Protein (Human)
RP028993	ABM	100 ug	Ask for price

SLC30A6 Recombinant Protein (Rat)
RP229400	ABM	100 ug	Ask for price

SLC30A6 Recombinant Protein (Mouse)
RP172883	ABM	100 ug	Ask for price

SLC30A6 Recombinant Protein (Mouse)
RP172886	ABM	100 ug	Ask for price

SLC30A6 Polyclonal Antibody, HRP Conjugated
A65431	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SLC30A6 Polyclonal Antibody, FITC Conjugated
A65432	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SLC30A6 Polyclonal Antibody, Biotin Conjugated
A65433	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Slc30a6 ORF Vector (Rat) (pORF)
ORF076468	ABM	1.0 ug DNA	EUR 506.00

SLC30A6 ORF Vector (Human) (pORF)
ORF009665	ABM	1.0 ug DNA	EUR 95.00

Slc30a6 ORF Vector (Mouse) (pORF)
ORF057629	ABM	1.0 ug DNA	EUR 506.00

Slc30a6 ORF Vector (Mouse) (pORF)
ORF057630	ABM	1.0 ug DNA	EUR 506.00

SLC30A6 ELISA Kit (Mouse) (OKCD01005)
OKCD01005	Aviva Systems Biology	96 Wells	EUR 857.00
Description: Description of target: Zinc-efflux transporter which allocates the cytoplasmic zinc to the trans-Golgi network (TGN) as well as the vesicular compartment.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Functional characterization of a novel mammalian zinc transporter, ZnT6."_x005F_x005F_x000D_Huang L., Kirschke C.P., Gitschier J._x005F_x005F_x000D_J. Biol. Chem. 277:26389-26395(2002) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

Slc30a6 sgRNA CRISPR Lentivector set (Rat)
K6124501	ABM	3 x 1.0 ug	EUR 339.00

Slc30a6 sgRNA CRISPR Lentivector set (Mouse)
K4850701	ABM	3 x 1.0 ug	EUR 339.00

SLC30A6 sgRNA CRISPR Lentivector set (Human)
K2183901	ABM	3 x 1.0 ug	EUR 339.00

Rat Zinc transporter 6(SLC30A6) ELISA kit
E02Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc transporter 6(SLC30A6) ELISA kit
E02Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc transporter 6(SLC30A6) ELISA kit
E02Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc transporter 6(SLC30A6) ELISA kit
E04Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc transporter 6(SLC30A6) ELISA kit
E04Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc transporter 6(SLC30A6) ELISA kit
E04Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc transporter 6(SLC30A6) ELISA kit
E03Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc transporter 6(SLC30A6) ELISA kit
E03Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc transporter 6(SLC30A6) ELISA kit
E03Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc transporter 6(SLC30A6) ELISA kit
E01Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc transporter 6(SLC30A6) ELISA kit
E01Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc transporter 6(SLC30A6) ELISA kit
E01Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc transporter 6(SLC30A6) ELISA kit
E08Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc transporter 6(SLC30A6) ELISA kit
E08Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc transporter 6(SLC30A6) ELISA kit
E08Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zinc transporter 6(SLC30A6) ELISA kit
E06Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zinc transporter 6(SLC30A6) ELISA kit
E06Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zinc transporter 6(SLC30A6) ELISA kit
E06Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zinc transporter 6(SLC30A6) ELISA kit
E07Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zinc transporter 6(SLC30A6) ELISA kit
E07Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zinc transporter 6(SLC30A6) ELISA kit
E07Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zinc transporter 6(SLC30A6) ELISA kit
E09Z0014-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zinc transporter 6(SLC30A6) ELISA kit
E09Z0014-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zinc transporter 6(SLC30A6) ELISA kit
E09Z0014-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Zinc transporter 6, SLC30A6 ELISA KIT
ELI-22659b	Lifescience Market	96 Tests	EUR 928.00

Chicken Zinc transporter 6, SLC30A6 ELISA KIT
ELI-28701c	Lifescience Market	96 Tests	EUR 928.00

Human Zinc transporter 6, SLC30A6 ELISA KIT
ELI-40801h	Lifescience Market	96 Tests	EUR 824.00

Mouse Zinc transporter 6, Slc30a6 ELISA KIT
ELI-40802m	Lifescience Market	96 Tests	EUR 865.00

Slc30a6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6124502	ABM	1.0 ug DNA	EUR 154.00

Slc30a6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6124503	ABM	1.0 ug DNA	EUR 154.00

Slc30a6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6124504	ABM	1.0 ug DNA	EUR 154.00

Slc30a6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4850702	ABM	1.0 ug DNA	EUR 154.00

Slc30a6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4850703	ABM	1.0 ug DNA	EUR 154.00

Slc30a6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4850704	ABM	1.0 ug DNA	EUR 154.00

SLC30A6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2183902	ABM	1.0 ug DNA	EUR 154.00

SLC30A6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2183903	ABM	1.0 ug DNA	EUR 154.00

SLC30A6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2183904	ABM	1.0 ug DNA	EUR 154.00