Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
DLR-SLC30A6-Hu-96T 96T
EUR 673.00
  • Should the Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Solute Carrier Family 30, Member 6 (SLC30A6) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
DLR-SLC30A6-Mu-48T 48T
EUR 527.00
  • Should the Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Solute Carrier Family 30, Member 6 (SLC30A6) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
DLR-SLC30A6-Mu-96T 96T
EUR 688.00
  • Should the Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Solute Carrier Family 30, Member 6 (SLC30A6) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Hu-48Tests 48 Tests
EUR 521.00
Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Hu-96Tests 96 Tests
EUR 723.00
Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Mu-48Tests 48 Tests
EUR 533.00
Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RD-SLC30A6-Mu-96Tests 96 Tests
EUR 740.00
Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Hu-48Tests 48 Tests
EUR 544.00
Human Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Hu-96Tests 96 Tests
EUR 756.00
Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Mu-48Tests 48 Tests
EUR 557.00
Mouse Solute Carrier Family 30, Member 6 (SLC30A6) ELISA Kit
RDR-SLC30A6-Mu-96Tests 96 Tests
EUR 774.00
SLC30A6 antibody
70R-20341 50 ul
EUR 435.00
Description: Rabbit polyclonal SLC30A6 antibody
SLC30A6 Antibody
47462-100ul 100ul
EUR 252.00
SLC30A6 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200
SLC30A6 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SLC30A6 Rabbit pAb
A11644-100ul 100 ul
EUR 308.00
SLC30A6 Rabbit pAb
A11644-200ul 200 ul
EUR 459.00
SLC30A6 Rabbit pAb
A11644-20ul 20 ul
EUR 183.00
SLC30A6 Rabbit pAb
A11644-50ul 50 ul
EUR 223.00
SLC30A6 Conjugated Antibody
C47462 100ul
EUR 397.00
SLC30A6 cloning plasmid
CSB-CL744010HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atgagtgtgtacagtgggaaagtcttactccagacaacaccaccccatgttattggtcagttggacaaactcatcagagaggtatctaccttagatggagttttagaagtccgaaatgaacatttttggaccctaggttttggctcattggctggatcagtgcatgtaagaattcg
  • Show more
Description: A cloning plasmid for the SLC30A6 gene.
SLC30A6 Polyclonal Antibody
A65430 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- SLC30A6 antibody
FNab07950 100µg
EUR 585.00
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: solute carrier family 30(zinc transporter), member 6
  • Uniprot ID: Q6NXT4
  • Gene ID: 55676
  • Research Area: Signal Transduction
Description: Antibody raised against SLC30A6
Anti-SLC30A6 antibody
PAab07950 100 ug
EUR 412.00
Anti-SLC30A6 antibody
STJ113247 100 µl
EUR 277.00
SLC30A6 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC30A6 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC30A6 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC30A6. Recognizes SLC30A6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
EF002999 96 Tests
EUR 689.00
Human SLC30A6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse SLC30A6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SLC30A6 Recombinant Protein (Human)
RP028993 100 ug Ask for price
SLC30A6 Recombinant Protein (Rat)
RP229400 100 ug Ask for price
SLC30A6 Recombinant Protein (Mouse)
RP172883 100 ug Ask for price
SLC30A6 Recombinant Protein (Mouse)
RP172886 100 ug Ask for price
SLC30A6 Polyclonal Antibody, HRP Conjugated
A65431 100 µg
EUR 570.55
Description: fast delivery possible
SLC30A6 Polyclonal Antibody, FITC Conjugated
A65432 100 µg
EUR 570.55
Description: reagents widely cited
SLC30A6 Polyclonal Antibody, Biotin Conjugated
A65433 100 µg
EUR 570.55
Description: Ask the seller for details
Slc30a6 ORF Vector (Rat) (pORF)
ORF076468 1.0 ug DNA
EUR 506.00
SLC30A6 ORF Vector (Human) (pORF)
ORF009665 1.0 ug DNA
EUR 95.00
Slc30a6 ORF Vector (Mouse) (pORF)
ORF057629 1.0 ug DNA
EUR 506.00
Slc30a6 ORF Vector (Mouse) (pORF)
ORF057630 1.0 ug DNA
EUR 506.00
SLC30A6 ELISA Kit (Mouse) (OKCD01005)
OKCD01005 96 Wells
EUR 857.00
Description: Description of target: Zinc-efflux transporter which allocates the cytoplasmic zinc to the trans-Golgi network (TGN) as well as the vesicular compartment.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Functional characterization of a novel mammalian zinc transporter, ZnT6."_x005F_x005F_x000D_Huang L., Kirschke C.P., Gitschier J._x005F_x005F_x000D_J. Biol. Chem. 277:26389-26395(2002) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL
Slc30a6 sgRNA CRISPR Lentivector set (Rat)
K6124501 3 x 1.0 ug
EUR 339.00
Slc30a6 sgRNA CRISPR Lentivector set (Mouse)
K4850701 3 x 1.0 ug
EUR 339.00
SLC30A6 sgRNA CRISPR Lentivector set (Human)
K2183901 3 x 1.0 ug
EUR 339.00
Rat Zinc transporter 6(SLC30A6) ELISA kit
E02Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Zinc transporter 6(SLC30A6) ELISA kit
E02Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Zinc transporter 6(SLC30A6) ELISA kit
E02Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Zinc transporter 6(SLC30A6) ELISA kit
E04Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Zinc transporter 6(SLC30A6) ELISA kit
E04Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Zinc transporter 6(SLC30A6) ELISA kit
E04Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Zinc transporter 6(SLC30A6) ELISA kit
E03Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Zinc transporter 6(SLC30A6) ELISA kit
E03Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Zinc transporter 6(SLC30A6) ELISA kit
E03Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Zinc transporter 6(SLC30A6) ELISA kit
E01Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Zinc transporter 6(SLC30A6) ELISA kit
E01Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Zinc transporter 6(SLC30A6) ELISA kit
E01Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Zinc transporter 6(SLC30A6) ELISA kit
E08Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Zinc transporter 6(SLC30A6) ELISA kit
E08Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Zinc transporter 6(SLC30A6) ELISA kit
E08Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Zinc transporter 6(SLC30A6) ELISA kit
E06Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Zinc transporter 6(SLC30A6) ELISA kit
E06Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Zinc transporter 6(SLC30A6) ELISA kit
E06Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Zinc transporter 6(SLC30A6) ELISA kit
E07Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Zinc transporter 6(SLC30A6) ELISA kit
E07Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Zinc transporter 6(SLC30A6) ELISA kit
E07Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Zinc transporter 6(SLC30A6) ELISA kit
E09Z0014-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Zinc transporter 6(SLC30A6) ELISA kit
E09Z0014-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Zinc transporter 6(SLC30A6) ELISA kit
E09Z0014-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zinc transporter 6(SLC30A6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Bovine Zinc transporter 6, SLC30A6 ELISA KIT
ELI-22659b 96 Tests
EUR 928.00
Chicken Zinc transporter 6, SLC30A6 ELISA KIT
ELI-28701c 96 Tests
EUR 928.00
Human Zinc transporter 6, SLC30A6 ELISA KIT
ELI-40801h 96 Tests
EUR 824.00
Mouse Zinc transporter 6, Slc30a6 ELISA KIT
ELI-40802m 96 Tests
EUR 865.00
Slc30a6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6124502 1.0 ug DNA
EUR 154.00
Slc30a6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6124503 1.0 ug DNA
EUR 154.00
Slc30a6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6124504 1.0 ug DNA
EUR 154.00
Slc30a6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4850702 1.0 ug DNA
EUR 154.00
Slc30a6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4850703 1.0 ug DNA
EUR 154.00
Slc30a6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4850704 1.0 ug DNA
EUR 154.00
SLC30A6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2183902 1.0 ug DNA
EUR 154.00
SLC30A6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2183903 1.0 ug DNA
EUR 154.00
SLC30A6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2183904 1.0 ug DNA
EUR 154.00