TMED2 antibody
23111-100ul 100ul
EUR 390
TMED2 antibody
70R-20858 50 ul
EUR 435
Description: Rabbit polyclonal TMED2 antibody
TMED2 antibody
70R-13646 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TMED2 antibody
TMED2 Antibody
43338-100ul 100ul
EUR 252
TMED2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
TMED2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TMED2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TMED2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMED2 Conjugated Antibody
C43338 100ul
EUR 397
TMED2 cloning plasmid
CSB-CL618982HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atggtgacgcttgctgaactgctggtgctcctggccgctctcctggccacggtctcgggctatttcgttagcatcgacgcccatgctgaagagtgcttctttgagcgggtcacctcgggcaccaagatgggcctcatcttcgaggtggcggagggcggcttcctggacatcgacgt
  • Show more
Description: A cloning plasmid for the TMED2 gene.
TMED2 Polyclonal Antibody
A61346 100 µg
EUR 570.55
Description: fast delivery possible
TMED2 Rabbit pAb
A17622-100ul 100 ul
EUR 308
TMED2 Rabbit pAb
A17622-200ul 200 ul
EUR 459
TMED2 Rabbit pAb
A17622-20ul 20 ul
EUR 183
TMED2 Rabbit pAb
A17622-50ul 50 ul
EUR 223
anti- TMED2 antibody
FNab08738 100µg
EUR 548.75
  • Immunogen: transmembrane emp24 domain trafficking protein 2
  • Uniprot ID: Q15363
  • Gene ID: 10959
  • Research Area: Signal Transduction
Description: Antibody raised against TMED2
Anti-TMED2 antibody
PAab08738 100 ug
EUR 386
Anti-TMED2 antibody
STJ119684 100 µl
EUR 277
TMED2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TMED2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TMED2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED2. Recognizes TMED2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse Tmed2 ELISA KIT
ELI-16304m 96 Tests
EUR 865
EF003641 96 Tests
EUR 689
Mouse TMED2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TMED2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TMED2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-40129h 96 Tests
EUR 824
TMED2 Recombinant Protein (Rat)
RP233387 100 ug Ask for price
TMED2 Recombinant Protein (Human)
RP031810 100 ug Ask for price
TMED2 Recombinant Protein (Mouse)
RP179150 100 ug Ask for price
TMED2 Polyclonal Antibody, Biotin Conjugated
A61347 100 µg
EUR 570.55
Description: reagents widely cited
TMED2 Polyclonal Antibody, FITC Conjugated
A61348 100 µg
EUR 570.55
Description: Ask the seller for details
TMED2 Polyclonal Antibody, HRP Conjugated
A61349 100 µg
EUR 570.55
Description: The best epigenetics products
Tmed2 ORF Vector (Rat) (pORF)
ORF077797 1.0 ug DNA
EUR 506
TMED2 ORF Vector (Human) (pORF)
ORF010604 1.0 ug DNA
EUR 95
Tmed2 ORF Vector (Mouse) (pORF)
ORF059718 1.0 ug DNA
EUR 506
Tmed2 sgRNA CRISPR Lentivector set (Rat)
K7608601 3 x 1.0 ug
EUR 339
TMED2 sgRNA CRISPR Lentivector set (Human)
K2385101 3 x 1.0 ug
EUR 339
Tmed2 sgRNA CRISPR Lentivector set (Mouse)
K3973201 3 x 1.0 ug
EUR 339
Tmed2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7608602 1.0 ug DNA
EUR 154
Tmed2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7608603 1.0 ug DNA
EUR 154
Tmed2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7608604 1.0 ug DNA
EUR 154
TMED2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385102 1.0 ug DNA
EUR 154
TMED2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385103 1.0 ug DNA
EUR 154
TMED2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385104 1.0 ug DNA
EUR 154
Tmed2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3973202 1.0 ug DNA
EUR 154
Tmed2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3973203 1.0 ug DNA
EUR 154
Tmed2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3973204 1.0 ug DNA
EUR 154
TMED2 Protein Vector (Rat) (pPB-C-His)
PV311186 500 ng
EUR 603
TMED2 Protein Vector (Rat) (pPB-N-His)
PV311187 500 ng
EUR 603
TMED2 Protein Vector (Rat) (pPM-C-HA)
PV311188 500 ng
EUR 603
TMED2 Protein Vector (Rat) (pPM-C-His)
PV311189 500 ng
EUR 603
TMED2 Protein Vector (Mouse) (pPB-C-His)
PV238870 500 ng
EUR 603
TMED2 Protein Vector (Mouse) (pPB-N-His)
PV238871 500 ng
EUR 603
TMED2 Protein Vector (Mouse) (pPM-C-HA)
PV238872 500 ng
EUR 603
TMED2 Protein Vector (Mouse) (pPM-C-His)
PV238873 500 ng
EUR 603
TMED2 Protein Vector (Human) (pPB-C-His)
PV042413 500 ng
EUR 329
TMED2 Protein Vector (Human) (pPB-N-His)
PV042414 500 ng
EUR 329
TMED2 Protein Vector (Human) (pPM-C-HA)
PV042415 500 ng
EUR 329
TMED2 Protein Vector (Human) (pPM-C-His)
PV042416 500 ng
EUR 329
Tmed2 3'UTR Luciferase Stable Cell Line
TU120599 1.0 ml Ask for price
Tmed2 3'UTR GFP Stable Cell Line
TU170599 1.0 ml Ask for price
Tmed2 3'UTR Luciferase Stable Cell Line
TU221985 1.0 ml Ask for price
TMED2 3'UTR GFP Stable Cell Line
TU075696 1.0 ml
EUR 1394
Tmed2 3'UTR GFP Stable Cell Line
TU271985 1.0 ml Ask for price
TMED2 3'UTR Luciferase Stable Cell Line
TU025696 1.0 ml
EUR 1394
Transmembrane Emp24 Domain-Containing Protein 2 (TMED2) Antibody
abx145350-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Transmembrane Emp24 Domain-Containing Protein 2 (TMED2) Antibody
abx238738-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Transmembrane emp24 domain-containing protein 2 (TMED2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transmembrane emp24 domain-containing protein 2 (TMED2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transmembrane Emp24 Domain-Containing Protein 2 (TMED2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMED2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV692371 1.0 ug DNA
EUR 514