TNFAIP3 Antibody
24884-100ul 100ul
EUR 390
TNFAIP3 Antibody
32613-100ul 100ul
EUR 252
TNFAIP3 Antibody
49053-100ul 100ul
EUR 333
TNFAIP3 Antibody
49053-50ul 50ul
EUR 239
TNFAIP3 Antibody
1-CSB-PA000775
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000
TNFAIP3 Antibody
DF6850 200ul
EUR 304
Description: TNFAIP3 Antibody detects endogenous levels of total TNFAIP3.
TNFAIP3 Antibody
CSB-PA257212-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500
TNFAIP3 Antibody
CSB-PA257212-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500
TNFAIP3 Antibody
CSB-PA023958KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
TNFAIP3 Antibody
CSB-PA023958KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
TNFAIP3 Antibody
1-CSB-PA023958LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:200
TNFAIP3 siRNA
20-abx937570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNFAIP3 siRNA
20-abx937571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNFAIP3 Antibody
ABD6850 100 ug
EUR 438
TNFAIP3 antibody
PAab10029 100 ug
EUR 386
anti-TNFAIP3
YF-PA24869 50 ul
EUR 334
Description: Mouse polyclonal to TNFAIP3
TNFAIP3 Rabbit pAb
A13637-100ul 100 ul
EUR 308
TNFAIP3 Rabbit pAb
A13637-200ul 200 ul
EUR 459
TNFAIP3 Rabbit pAb
A13637-20ul 20 ul
EUR 183
TNFAIP3 Rabbit pAb
A13637-50ul 50 ul
EUR 223
TNFAIP3 Blocking Peptide
DF6850-BP 1mg
EUR 195
TNFAIP3 Conjugated Antibody
C49053 100ul
EUR 397
Polyclonal TNFAIP3 Antibody
APR06534G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 . This antibody is tested and proven to work in the following applications:
Polyclonal TNFAIP3 Antibody
APR06537G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 . This antibody is tested and proven to work in the following applications:
TNFAIP3 cloning plasmid
CSB-CL023958HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctca
  • Show more
Description: A cloning plasmid for the TNFAIP3 gene.
TNFAIP3 cloning plasmid
CSB-CL023958HU2-10ug 10ug
EUR 775
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2373
  • Sequence: ATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTC
  • Show more
Description: A cloning plasmid for the TNFAIP3 gene.
TNFAIP3 Rabbit mAb
A19128-100ul 100 ul
EUR 410
TNFAIP3 Rabbit mAb
A19128-200ul 200 ul
EUR 571
TNFAIP3 Rabbit mAb
A19128-20ul 20 ul
EUR 221
TNFAIP3 Rabbit mAb
A19128-50ul 50 ul
EUR 287
TNFAIP3 Rabbit pAb
A2127-100ul 100 ul
EUR 308
TNFAIP3 Rabbit pAb
A2127-200ul 200 ul
EUR 459
TNFAIP3 Rabbit pAb
A2127-20ul 20 ul
EUR 183
TNFAIP3 Rabbit pAb
A2127-50ul 50 ul
EUR 223
anti- TNFAIP3 antibody
FNab08818 100µg
EUR 548.75
  • Immunogen: tumor necrosis factor, alpha-induced protein 3
  • Uniprot ID: P21580
  • Gene ID: 7128
  • Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3
anti- TNFAIP3 antibody
FNab10029 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: tumor necrosis factor, alpha-induced protein 3
  • Uniprot ID: P21580
  • Gene ID: 7128
  • Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3
anti- TNFAIP3 antibody
FNab10156 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: tumor necrosis factor, alpha-induced protein 3
  • Uniprot ID: P21580
  • Gene ID: 7128
  • Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3
Anti-TNFAIP3 antibody
PAab08818 100 ug
EUR 386
Anti-TNFAIP3 antibody
STJ11100029 100 µl
EUR 413
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.
Anti-TNFAIP3 antibody
STJ25884 100 µl
EUR 277
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.
Anti-TNFAIP3 antibody
STJ115596 100 µl
EUR 277
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.
Anti-TNFAIP3 Antibody
STJ500012 100 µg
EUR 476
Human TNFAIP3 ELISA Kit
ELA-E9843h 96 Tests
EUR 824
TNFAIP3 ELISA KIT|Human
EF006550 96 Tests
EUR 689
Polyclonal TNFAIP3 / A20 Antibody
APG01072G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNFAIP3 / A20 . This antibody is tested and proven to work in the following applications:
Mouse TNFAIP3 shRNA Plasmid
20-abx973152
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNFAIP3 Antibody, HRP conjugated
1-CSB-PA023958LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TNFAIP3 Antibody, FITC conjugated
1-CSB-PA023958LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TNFAIP3 Antibody, Biotin conjugated
1-CSB-PA023958LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human TNFAIP3 shRNA Plasmid
20-abx954889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNFAIP3 recombinant monoclonal antibody
A5354 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TNFAIP3 for WB, IHC,ELISA
Anti-TNFAIP3 Antibody (Biotin)
STJ500013 100 µg
EUR 586
Anti-TNFAIP3 Antibody (FITC)
STJ500014 100 µg
EUR 586
TNFAIP3 Interacting Protein 1 Protein
20-abx263201
  • EUR 230.00
  • EUR 1483.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.
[KO Validated] TNFAIP3 Rabbit pAb
A18056-100ul 100 ul
EUR 410
[KO Validated] TNFAIP3 Rabbit pAb
A18056-200ul 200 ul
EUR 571
[KO Validated] TNFAIP3 Rabbit pAb
A18056-20ul 20 ul
EUR 221
[KO Validated] TNFAIP3 Rabbit pAb
A18056-50ul 50 ul
EUR 287
TNFAIP3 ORF Vector (Human) (pORF)
ORF014784 1.0 ug DNA
EUR 354
TNFAIP3 ORF Vector (Human) (pORF)
ORF010799 1.0 ug DNA
EUR 95
Tnfaip3 ORF Vector (Mouse) (pORF)
ORF060057 1.0 ug DNA
EUR 506
Tnfaip3 ORF Vector (Mouse) (pORF)
ORF060058 1.0 ug DNA
EUR 506
pIRES2-DsRed2-HA-TNFAIP3 Plasmid
PVTB00457-2a 2 ug
EUR 356
pECMV-Tnfaip3-m-FLAG Plasmid
PVT15715 2 ug
EUR 325
TNFAIP3 ELISA Kit (Human) (OKAN05986)
OKAN05986 96 Wells
EUR 792
Description: Description of target: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL
TNFAIP3 ELISA Kit (Human) (OKCD08256)
OKCD08256 96 Wells
EUR 975
Description: Description of target: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 30pg/mL
TNFAIP3 ELISA Kit (Mouse) (OKEH04954)
OKEH04954 96 Wells
EUR 727
Description: Description of target: Ubiquitin-editing enzyme that contains both ubiquitin ligase and deubiquitinase activities. Involved in immune and inflammatory responses signaled by cytokines, such as TNF-alpha and IL-1 beta, or pathogens via Toll-like receptors (TLRs) through terminating NF-kappa-B activity. Essential component of a ubiquitin-editing protein complex, comprising also RNF11, ITCH and TAX1BP1, that ensures the transient nature of inflammatory signaling pathways. In cooperation with TAX1BP1 promotes disassembly of E2-E3 ubiquitin protein ligase complexes in IL-1R and TNFR-1 pathways; affected are at least E3 ligases TRAF6, TRAF2 and BIRC2, and E2 ubiquitin-conjugating enzymes UBE2N and UBE2D3. In cooperation with TAX1BP1 promotes ubiquitination of UBE2N and proteasomal degradation of UBE2N and UBE2D3. Upon TNF stimulation, deubiquitinates 'Lys-63'-polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NF-kappa-B. Deubiquitinates TRAF6 probably acting on 'Lys-63'-linked polyubiquitin. Upon T-cell receptor (TCR)-mediated T-cell activation, deubiquitinates 'Lys-63'-polyubiquitin chains on MALT1 thereby mediating disassociation of the CBM (CARD11:BCL10:MALT1) and IKK complexes and preventing sustained IKK activation. Deubiquitinates NEMO/IKBKG; the function is facilitated by TNIP1 and leads to inhibition of NF-kappa-B activation. Upon stimulation by bacterial peptidoglycans, probably deubiquitinates RIPK2. Can also inhibit I-kappa-B-kinase (IKK) through a non-catalytic mechanism which involves polyubiquitin; polyubiquitin promotes association with IKBKG and prevents IKK MAP3K7-mediated phosphorylation. Targets TRAF2 for lysosomal degradation. In vitro able to deubiquitinate 'Lys-11'-, 'Lys-48'- and 'Lys-63' polyubiquitin chains. Inhibitor of programmed cell death. Has a role in the function of the lymphoid system. Required for LPS-induced production of proinflammatory cytokines and IFN beta in LPS-tolerized macrophages.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.174 ng/mL
Recombinant Human TNFAIP3 Interacting Protein 1
7-06673 1µg Ask for price
Recombinant Human TNFAIP3 Interacting Protein 1
7-06674 5µg Ask for price
Recombinant Human TNFAIP3 Interacting Protein 1
7-06675 50µg Ask for price
Polyclonal TNFAIP3 / A20 Antibody (C-Terminus)
APR02637G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 / A20 (C-Terminus). This antibody is tested and proven to work in the following applications:
TNFAIP3-Interacting Protein 2 (TNIP2) Antibody
20-abx003779
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
20-abx003286
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx211190
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3 Interacting Protein 3 (TNIP3) Antibody
20-abx212129
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.