TNFAIP3

TNFAIP3 siRNA
20-abx937571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNFAIP3 Antibody
ABD6850 100 ug
EUR 438.00
TNFAIP3 Antibody
49053-100ul 100ul
EUR 333.00
TNFAIP3 Antibody
49053-50ul 50ul
EUR 239.00
TNFAIP3 Antibody
1-CSB-PA000775
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000
TNFAIP3 Antibody
CSB-PA257212-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500
TNFAIP3 Antibody
CSB-PA257212-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500
TNFAIP3 Antibody
DF6850 200ul
EUR 304.00
Description: TNFAIP3 Antibody detects endogenous levels of total TNFAIP3.
TNFAIP3 Antibody
24878-100ul 100ul
EUR 390.00
TNFAIP3 Antibody
24884-100ul 100ul
EUR 390.00
TNFAIP3 Antibody
32613-100ul 100ul
EUR 252.00
TNFAIP3 Antibody
CSB-PA023958KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
TNFAIP3 Antibody
CSB-PA023958KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
TNFAIP3 Antibody
1-CSB-PA023958LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:200
TNFAIP3 antibody
PAab10029 100 ug
EUR 386.00
anti-TNFAIP3
YF-PA24869 50 ul
EUR 334.00
Description: Mouse polyclonal to TNFAIP3
TNFAIP3 Polyclonal Antibody
E-AB-30378-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis
  • Show more
Description: Rabbit antibody against Human,Mouse TNFAIP3 for WB,IF,ELISA applications.
TNFAIP3 Polyclonal Antibody
E-AB-30378-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis
  • Show more
Description: Rabbit antibody against Human,Mouse TNFAIP3 for WB,IF,ELISA applications.
TNFAIP3 Polyclonal Antibody
E-AB-30378-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis
  • Show more
Description: Rabbit antibody against Human,Mouse TNFAIP3 for WB,IF,ELISA applications.
TNFAIP3 Rabbit mAb
A19128-100ul 100 ul
EUR 410.00
TNFAIP3 Rabbit mAb
A19128-200ul 200 ul
EUR 571.00
TNFAIP3 Rabbit mAb
A19128-20ul 20 ul
EUR 221.00
TNFAIP3 Rabbit mAb
A19128-50ul 50 ul
EUR 287.00
TNFAIP3 Rabbit pAb
A2127-100ul 100 ul
EUR 308.00
TNFAIP3 Rabbit pAb
A2127-200ul 200 ul
EUR 459.00
TNFAIP3 Rabbit pAb
A2127-20ul 20 ul
EUR 183.00
TNFAIP3 Rabbit pAb
A2127-50ul 50 ul
EUR 223.00
TNFAIP3 Rabbit pAb
A13637-100ul 100 ul
EUR 308.00
TNFAIP3 Rabbit pAb
A13637-200ul 200 ul
EUR 459.00
TNFAIP3 Rabbit pAb
A13637-20ul 20 ul
EUR 183.00
TNFAIP3 Rabbit pAb
A13637-50ul 50 ul
EUR 223.00
TNFAIP3 Blocking Peptide
DF6850-BP 1mg
EUR 195.00
TNFAIP3 Conjugated Antibody
C49053 100ul
EUR 397.00
TNFAIP3 cloning plasmid
CSB-CL023958HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctca
  • Show more
Description: A cloning plasmid for the TNFAIP3 gene.
TNFAIP3 cloning plasmid
CSB-CL023958HU2-10ug 10ug
EUR 775.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2373
  • Sequence: ATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTC
  • Show more
Description: A cloning plasmid for the TNFAIP3 gene.
Polyclonal TNFAIP3 Antibody
APR06534G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 . This antibody is tested and proven to work in the following applications:
Polyclonal TNFAIP3 Antibody
APR06537G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 . This antibody is tested and proven to work in the following applications:
Anti-TNFAIP3 antibody
PAab08818 100 ug
EUR 386.00
anti- TNFAIP3 antibody
FNab10029 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: tumor necrosis factor, alpha-induced protein 3
  • Uniprot ID: P21580
  • Gene ID: 7128
  • Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3
anti- TNFAIP3 antibody
FNab10156 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: tumor necrosis factor, alpha-induced protein 3
  • Uniprot ID: P21580
  • Gene ID: 7128
  • Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3
anti- TNFAIP3 antibody
FNab08818 100µg
EUR 548.75
  • Immunogen: tumor necrosis factor, alpha-induced protein 3
  • Uniprot ID: P21580
  • Gene ID: 7128
  • Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3
Anti-TNFAIP3 antibody
STJ11100029 100 µl
EUR 413.00
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.
Anti-TNFAIP3 antibody
STJ115596 100 µl
EUR 277.00
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.
Anti-TNFAIP3 Antibody
STJ500012 100 µg
EUR 476.00
Anti-TNFAIP3 antibody
STJ25884 100 µl
EUR 277.00
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.
Human TNFAIP3 shRNA Plasmid
20-abx954889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TNFAIP3 shRNA Plasmid
20-abx973152
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNFAIP3 recombinant monoclonal antibody
A5354 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TNFAIP3 for WB, IHC,ELISA
TNFAIP3 Antibody, HRP conjugated
1-CSB-PA023958LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TNFAIP3 Antibody, FITC conjugated
1-CSB-PA023958LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TNFAIP3 Antibody, Biotin conjugated
1-CSB-PA023958LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal TNFAIP3 / A20 Antibody
APG01072G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNFAIP3 / A20 . This antibody is tested and proven to work in the following applications:
Human TNFAIP3 ELISA Kit
ELA-E9843h 96 Tests
EUR 824.00
TNFAIP3 ELISA KIT|Human
EF006550 96 Tests
EUR 689.00
Anti-TNFAIP3 Antibody (Biotin)
STJ500013 100 µg
EUR 586.00
Anti-TNFAIP3 Antibody (FITC)
STJ500014 100 µg
EUR 586.00
TNFAIP3 Interacting Protein 1 Protein
20-abx263201
  • EUR 230.00
  • EUR 1483.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.
[KO Validated] TNFAIP3 Rabbit pAb
A18056-100ul 100 ul
EUR 410.00
[KO Validated] TNFAIP3 Rabbit pAb
A18056-200ul 200 ul
EUR 571.00
[KO Validated] TNFAIP3 Rabbit pAb
A18056-20ul 20 ul
EUR 221.00
[KO Validated] TNFAIP3 Rabbit pAb
A18056-50ul 50 ul
EUR 287.00
TNFAIP3 ORF Vector (Human) (pORF)
ORF014784 1.0 ug DNA
EUR 354.00
Tnfaip3 ORF Vector (Mouse) (pORF)
ORF060057 1.0 ug DNA
EUR 506.00
Tnfaip3 ORF Vector (Mouse) (pORF)
ORF060058 1.0 ug DNA
EUR 506.00
TNFAIP3 ORF Vector (Human) (pORF)
ORF010799 1.0 ug DNA
EUR 95.00
pIRES2-DsRed2-HA-TNFAIP3 Plasmid
PVTB00457-2a 2 ug
EUR 356.00
pECMV-Tnfaip3-m-FLAG Plasmid
PVT15715 2 ug
EUR 325.00
TNFAIP3 Interacting Protein 3 (TNIP3) Antibody
20-abx212129
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx213274
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx338692
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
abx238831-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.
TNFAIP3-Interacting Protein 2 (TNIP2) Antibody
abx238832-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx211190
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Human TNFAIP3 Interacting Protein 1
7-06673 1µg Ask for price
Recombinant Human TNFAIP3 Interacting Protein 1
7-06674 5µg Ask for price