TNFAIP3

TNFAIP3 siRNA
20-abx937571	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TNFAIP3 Antibody
ABD6850	Lifescience Market	100 ug	EUR 438.00

TNFAIP3 Antibody
49053-100ul	SAB	100ul	EUR 333.00

TNFAIP3 Antibody
49053-50ul	SAB	50ul	EUR 239.00

TNFAIP3 Antibody
1-CSB-PA000775	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

TNFAIP3 Antibody
CSB-PA257212-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

TNFAIP3 Antibody
CSB-PA257212-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

TNFAIP3 Antibody
DF6850	Affbiotech	200ul	EUR 304.00
Description: TNFAIP3 Antibody detects endogenous levels of total TNFAIP3.

TNFAIP3 Antibody
24878-100ul	SAB	100ul	EUR 390.00

TNFAIP3 Antibody
24884-100ul	SAB	100ul	EUR 390.00

TNFAIP3 Antibody
32613-100ul	SAB	100ul	EUR 252.00

TNFAIP3 Antibody
CSB-PA023958KA01HU-	Cusabio		EUR 335.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TNFAIP3 Antibody
CSB-PA023958KA01HU-100ul	Cusabio	100ul	EUR 389.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TNFAIP3 Antibody
1-CSB-PA023958LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:200

TNFAIP3 antibody
PAab10029	Lifescience Market	100 ug	EUR 386.00

anti-TNFAIP3
YF-PA24869	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to TNFAIP3

TNFAIP3 Polyclonal Antibody
E-AB-30378-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis Show more
Description: Rabbit antibody against Human,Mouse TNFAIP3 for WB,IF,ELISA applications.

TNFAIP3 Polyclonal Antibody
E-AB-30378-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis Show more
Description: Rabbit antibody against Human,Mouse TNFAIP3 for WB,IF,ELISA applications.

TNFAIP3 Polyclonal Antibody
E-AB-30378-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis Show more
Description: Rabbit antibody against Human,Mouse TNFAIP3 for WB,IF,ELISA applications.

TNFAIP3 Rabbit mAb
A19128-100ul	Abclonal	100 ul	EUR 410.00

TNFAIP3 Rabbit mAb
A19128-200ul	Abclonal	200 ul	EUR 571.00

TNFAIP3 Rabbit mAb
A19128-20ul	Abclonal	20 ul	EUR 221.00

TNFAIP3 Rabbit mAb
A19128-50ul	Abclonal	50 ul	EUR 287.00

TNFAIP3 Rabbit pAb
A2127-100ul	Abclonal	100 ul	EUR 308.00

TNFAIP3 Rabbit pAb
A2127-200ul	Abclonal	200 ul	EUR 459.00

TNFAIP3 Rabbit pAb
A2127-20ul	Abclonal	20 ul	EUR 183.00

TNFAIP3 Rabbit pAb
A2127-50ul	Abclonal	50 ul	EUR 223.00

TNFAIP3 Rabbit pAb
A13637-100ul	Abclonal	100 ul	EUR 308.00

TNFAIP3 Rabbit pAb
A13637-200ul	Abclonal	200 ul	EUR 459.00

TNFAIP3 Rabbit pAb
A13637-20ul	Abclonal	20 ul	EUR 183.00

TNFAIP3 Rabbit pAb
A13637-50ul	Abclonal	50 ul	EUR 223.00

TNFAIP3 Blocking Peptide
DF6850-BP	Affbiotech	1mg	EUR 195.00

TNFAIP3 Conjugated Antibody
C49053	SAB	100ul	EUR 397.00

TNFAIP3 cloning plasmid
CSB-CL023958HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 747 Sequence: atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctca Show more
Description: A cloning plasmid for the TNFAIP3 gene.

TNFAIP3 cloning plasmid
CSB-CL023958HU2-10ug	Cusabio	10ug	EUR 775.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2373 Sequence: ATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTC Show more
Description: A cloning plasmid for the TNFAIP3 gene.

Polyclonal TNFAIP3 Antibody
APR06534G	Leading Biology	0.1 mg	EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 . This antibody is tested and proven to work in the following applications:

Polyclonal TNFAIP3 Antibody
APR06537G	Leading Biology	0.1 mg	EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFAIP3 . This antibody is tested and proven to work in the following applications:

Anti-TNFAIP3 antibody
PAab08818	Lifescience Market	100 ug	EUR 386.00

anti- TNFAIP3 antibody
FNab10029	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:500 Immunogen: tumor necrosis factor, alpha-induced protein 3 Uniprot ID: P21580 Gene ID: 7128 Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3

anti- TNFAIP3 antibody
FNab10156	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:500 Immunogen: tumor necrosis factor, alpha-induced protein 3 Uniprot ID: P21580 Gene ID: 7128 Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3

anti- TNFAIP3 antibody
FNab08818	FN Test	100µg	EUR 548.75
Immunogen: tumor necrosis factor, alpha-induced protein 3 Uniprot ID: P21580 Gene ID: 7128 Research Area: Stem Cells, Immunology, Metabolism
Description: Antibody raised against TNFAIP3

Anti-TNFAIP3 antibody
STJ11100029	St John's Laboratory	100 µl	EUR 413.00
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.

Anti-TNFAIP3 antibody
STJ115596	St John's Laboratory	100 µl	EUR 277.00
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.

Anti-TNFAIP3 Antibody
STJ500012	St John's Laboratory	100 µg	EUR 476.00

Anti-TNFAIP3 antibody
STJ25884	St John's Laboratory	100 µl	EUR 277.00
Description: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene.

Human TNFAIP3 shRNA Plasmid
20-abx954889	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TNFAIP3 shRNA Plasmid
20-abx973152	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TNFAIP3 recombinant monoclonal antibody
A5354	Bimake	100ul X 3	EUR 595.00
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human TNFAIP3 for WB, IHC,ELISA

TNFAIP3 Antibody, HRP conjugated
1-CSB-PA023958LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNFAIP3 Antibody, FITC conjugated
1-CSB-PA023958LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNFAIP3 Antibody, Biotin conjugated
1-CSB-PA023958LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFAIP3. Recognizes TNFAIP3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal TNFAIP3 / A20 Antibody
APG01072G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TNFAIP3 / A20 . This antibody is tested and proven to work in the following applications:

Human TNFAIP3 ELISA Kit
ELA-E9843h	Lifescience Market	96 Tests	EUR 824.00

TNFAIP3 ELISA KIT|Human
EF006550	Lifescience Market	96 Tests	EUR 689.00

Anti-TNFAIP3 Antibody (Biotin)
STJ500013	St John's Laboratory	100 µg	EUR 586.00

Anti-TNFAIP3 Antibody (FITC)
STJ500014	St John's Laboratory	100 µg	EUR 586.00

TNFAIP3 Interacting Protein 1 Protein
20-abx263201	Abbexa	EUR 230.00 EUR 1483.00 EUR 328.00	1 µg 50 ug 5 ug
Shipped within 5-10 working days.

[KO Validated] TNFAIP3 Rabbit pAb
A18056-100ul	Abclonal	100 ul	EUR 410.00

[KO Validated] TNFAIP3 Rabbit pAb
A18056-200ul	Abclonal	200 ul	EUR 571.00

[KO Validated] TNFAIP3 Rabbit pAb
A18056-20ul	Abclonal	20 ul	EUR 221.00

[KO Validated] TNFAIP3 Rabbit pAb
A18056-50ul	Abclonal	50 ul	EUR 287.00

TNFAIP3 ORF Vector (Human) (pORF)
ORF014784	ABM	1.0 ug DNA	EUR 354.00

Tnfaip3 ORF Vector (Mouse) (pORF)
ORF060057	ABM	1.0 ug DNA	EUR 506.00

Tnfaip3 ORF Vector (Mouse) (pORF)
ORF060058	ABM	1.0 ug DNA	EUR 506.00

TNFAIP3 ORF Vector (Human) (pORF)
ORF010799	ABM	1.0 ug DNA	EUR 95.00

pIRES2-DsRed2-HA-TNFAIP3 Plasmid
PVTB00457-2a	Lifescience Market	2 ug	EUR 356.00

pECMV-Tnfaip3-m-FLAG Plasmid
PVT15715	Lifescience Market	2 ug	EUR 325.00

TNFAIP3 Interacting Protein 3 (TNIP3) Antibody
20-abx212129	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx213274	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx338692	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
abx238831-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

TNFAIP3-Interacting Protein 2 (TNIP2) Antibody
abx238832-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx211190	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Human TNFAIP3 Interacting Protein 1
7-06673	CHI Scientific	1µg	Ask for price

Recombinant Human TNFAIP3 Interacting Protein 1
7-06674	CHI Scientific	5µg	Ask for price