UBE2B

UBE2B Antibody
1-CSB-PA025439GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
UBE2B Antibody
1-CSB-PA778345
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
UBE2B Antibody
1-CSB-PA170670
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
UBE2B antibody
22642-100ul 100ul
EUR 390.00
UBE2B Antibody
42801-100ul 100ul
EUR 252.00
UBE2B antibody
38818-100ul 100ul
EUR 252.00
UBE2B antibody
70R-21096 50 ul
EUR 435.00
Description: Rabbit polyclonal UBE2B antibody
UBE2B siRNA
20-abx905903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2B siRNA
20-abx938755
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2B siRNA
20-abx938756
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2B antibody
70R-12534 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal UBE2B antibody
anti-Ube2B
YF-PA15195 50 ul
EUR 363.00
Description: Mouse polyclonal to Ube2B
anti-Ube2B
YF-PA15196 50 ug
EUR 363.00
Description: Mouse polyclonal to Ube2B
anti-Ube2B
YF-PA24926 50 ul
EUR 334.00
Description: Mouse polyclonal to Ube2B
UBE2B Conjugated Antibody
C38818 100ul
EUR 397.00
UBE2A/UBE2B Antibody
1-CSB-PA004716
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBE2A/UBE2B. Recognizes UBE2A/UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
UBE2B cloning plasmid
CSB-CL025439HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atgtcgaccccggcccggaggaggctcatgcgggatttcaagcggttacaagaggacccacctgtgggtgtcagtggcgcaccatctgaaaacaacatcatgcagtggaatgcagttatatttggaccagaagggacaccttttgaagatggtacttttaaactagtaatagaatt
  • Show more
Description: A cloning plasmid for the UBE2B gene.
UBE2B Rabbit pAb
A6315-100ul 100 ul
EUR 308.00
UBE2B Rabbit pAb
A6315-200ul 200 ul
EUR 459.00
UBE2B Rabbit pAb
A6315-20ul 20 ul
EUR 183.00
UBE2B Rabbit pAb
A6315-50ul 50 ul
EUR 223.00
UBE2A / UBE2B Antibody
20-abx327177
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
anti- UBE2B antibody
FNab09164 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ubiquitin-conjugating enzyme E2B (RAD6 homolog)
  • Uniprot ID: P63146
  • Gene ID: 7320
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism, Developmental biology
Description: Antibody raised against UBE2B
Anti-UBE2B antibody
PAab09164 100 ug
EUR 386.00
Anti-UBE2B antibody
STJ28237 100 µl
EUR 277.00
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution.
Anti-Ube2B (4C3)
YF-MA15999 100 ug
EUR 363.00
Description: Mouse monoclonal to Ube2B
Anti-Ube2B (1F11)
YF-MA16000 100 ug
EUR 363.00
Description: Mouse monoclonal to Ube2B
Rat UBE2B shRNA Plasmid
20-abx986731
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UBE2B shRNA Plasmid
20-abx955003
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UBE2B shRNA Plasmid
20-abx973290
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2B protein (His tag)
80R-1333 50 ug
EUR 305.00
Description: Purified recombinant Human UBE2B protein
UBE2B ELISA KIT|Human
EF003993 96 Tests
EUR 689.00
UBE2B Recombinant Protein (Human)
RP033670 100 ug Ask for price
UBE2B Recombinant Protein (Mouse)
RP182618 100 ug Ask for price
UBE2B Recombinant Protein (Rat)
RP235520 100 ug Ask for price
UBE2B ORF Vector (Human) (pORF)
ORF011224 1.0 ug DNA
EUR 95.00
Ube2b ORF Vector (Mouse) (pORF)
ORF060874 1.0 ug DNA
EUR 506.00
Ube2b ORF Vector (Rat) (pORF)
ORF078508 1.0 ug DNA
EUR 506.00
pECMV-Ube2b-m-FLAG Plasmid
PVT15408 2 ug
EUR 325.00
UBE2B sgRNA CRISPR Lentivector set (Human)
K2570401 3 x 1.0 ug
EUR 339.00
Ube2b sgRNA CRISPR Lentivector set (Rat)
K7048301 3 x 1.0 ug
EUR 339.00
Ube2b sgRNA CRISPR Lentivector set (Mouse)
K3365901 3 x 1.0 ug
EUR 339.00
Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
abx122398-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Monoclonal UBE2B Antibody (monoclonal) (M06), Clone: 4C3
APR10639G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human UBE2B (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4C3. This antibody is applicable in WB, E
Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx004827
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx141838
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
abx239164-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx241159
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx241160
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
UBE2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2570402 1.0 ug DNA
EUR 154.00
UBE2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2570403 1.0 ug DNA
EUR 154.00
UBE2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2570404 1.0 ug DNA
EUR 154.00
Ube2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7048302 1.0 ug DNA
EUR 154.00
Ube2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7048303 1.0 ug DNA
EUR 154.00
Ube2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7048304 1.0 ug DNA
EUR 154.00
Ube2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3365902 1.0 ug DNA
EUR 154.00
Ube2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3365903 1.0 ug DNA
EUR 154.00
Ube2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3365904 1.0 ug DNA
EUR 154.00
UBE2B Protein Vector (Rat) (pPB-C-His)
PV314030 500 ng
EUR 603.00
UBE2B Protein Vector (Rat) (pPB-N-His)
PV314031 500 ng
EUR 603.00
UBE2B Protein Vector (Rat) (pPM-C-HA)
PV314032 500 ng
EUR 603.00
UBE2B Protein Vector (Rat) (pPM-C-His)
PV314033 500 ng
EUR 603.00
UBE2B Protein Vector (Mouse) (pPB-C-His)
PV243494 500 ng
EUR 603.00
UBE2B Protein Vector (Mouse) (pPB-N-His)
PV243495 500 ng
EUR 603.00
UBE2B Protein Vector (Mouse) (pPM-C-HA)
PV243496 500 ng
EUR 603.00
UBE2B Protein Vector (Mouse) (pPM-C-His)
PV243497 500 ng
EUR 603.00
UBE2B Protein Vector (Human) (pPB-C-His)
PV044893 500 ng
EUR 329.00
UBE2B Protein Vector (Human) (pPB-N-His)
PV044894 500 ng
EUR 329.00
UBE2B Protein Vector (Human) (pPM-C-HA)
PV044895 500 ng
EUR 329.00
UBE2B Protein Vector (Human) (pPM-C-His)
PV044896 500 ng
EUR 329.00
Recombinant Human UBE2B Protein, His, E.coli-10ug
QP13853-10ug 10ug
EUR 201.00
Recombinant Human UBE2B Protein, His, E.coli-1mg
QP13853-1mg 1mg
EUR 5251.00
Recombinant Human UBE2B Protein, His, E.coli-2ug
QP13853-2ug 2ug
EUR 155.00
Ube2b 3'UTR Luciferase Stable Cell Line
TU121449 1.0 ml Ask for price
UBE2B 3'UTR Luciferase Stable Cell Line
TU027641 1.0 ml
EUR 1521.00