UBE2B antibody
22642-100ul	SAB	100ul	EUR 390

UBE2B antibody
70R-12534	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal UBE2B antibody

UBE2B antibody
70R-21096	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UBE2B antibody

UBE2B antibody
38818-100ul	SAB	100ul	EUR 252

UBE2B Antibody
42801-100ul	SAB	100ul	EUR 252

UBE2B Antibody
1-CSB-PA778345	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

UBE2B Antibody
1-CSB-PA170670	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

UBE2B Antibody
1-CSB-PA025439GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

UBE2B siRNA
20-abx905903	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBE2B siRNA
20-abx938755	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBE2B siRNA
20-abx938756	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-Ube2B
YF-PA15195	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Ube2B

anti-Ube2B
YF-PA15196	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Ube2B

anti-Ube2B
YF-PA24926	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Ube2B

UBE2A/UBE2B Antibody
1-CSB-PA004716	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBE2A/UBE2B. Recognizes UBE2A/UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

UBE2B Conjugated Antibody
C38818	SAB	100ul	EUR 397

UBE2A / UBE2B Antibody
20-abx327177	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

UBE2B cloning plasmid
CSB-CL025439HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 459 Sequence: atgtcgaccccggcccggaggaggctcatgcgggatttcaagcggttacaagaggacccacctgtgggtgtcagtggcgcaccatctgaaaacaacatcatgcagtggaatgcagttatatttggaccagaagggacaccttttgaagatggtacttttaaactagtaatagaatt Show more
Description: A cloning plasmid for the UBE2B gene.

UBE2B Rabbit pAb
A6315-100ul	Abclonal	100 ul	EUR 308

UBE2B Rabbit pAb
A6315-200ul	Abclonal	200 ul	EUR 459

UBE2B Rabbit pAb
A6315-20ul	Abclonal	20 ul	EUR 183

UBE2B Rabbit pAb
A6315-50ul	Abclonal	50 ul	EUR 223

anti- UBE2B antibody
FNab09164	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: ubiquitin-conjugating enzyme E2B (RAD6 homolog) Uniprot ID: P63146 Gene ID: 7320 Research Area: Epigenetics, Cell Division and Proliferation, Metabolism, Developmental biology
Description: Antibody raised against UBE2B

Anti-UBE2B antibody
PAab09164	Lifescience Market	100 ug	EUR 386

Anti-UBE2B antibody
STJ28237	St John's Laboratory	100 µl	EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution.

Anti-Ube2B (4C3)
YF-MA15999	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Ube2B

Anti-Ube2B (1F11)
YF-MA16000	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Ube2B

UBE2B protein (His tag)
80R-1333	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human UBE2B protein

UBE2B ELISA KIT|Human
EF003993	Lifescience Market	96 Tests	EUR 689

Mouse UBE2B shRNA Plasmid
20-abx973290	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat UBE2B shRNA Plasmid
20-abx986731	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UBE2B shRNA Plasmid
20-abx955003	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UBE2B Recombinant Protein (Rat)
RP235520	ABM	100 ug	Ask for price

UBE2B Recombinant Protein (Human)
RP033670	ABM	100 ug	Ask for price

UBE2B Recombinant Protein (Mouse)
RP182618	ABM	100 ug	Ask for price

Ube2b ORF Vector (Rat) (pORF)
ORF078508	ABM	1.0 ug DNA	EUR 506

UBE2B ORF Vector (Human) (pORF)
ORF011224	ABM	1.0 ug DNA	EUR 95

Ube2b ORF Vector (Mouse) (pORF)
ORF060874	ABM	1.0 ug DNA	EUR 506

pECMV-Ube2b-m-FLAG Plasmid
PVT15408	Lifescience Market	2 ug	EUR 325

UBE2B ELISA Kit (Human) (OKEH07630)
OKEH07630	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% (n = 20) identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.47ng/mL

Ube2b sgRNA CRISPR Lentivector set (Rat)
K7048301	ABM	3 x 1.0 ug	EUR 339

Ube2b sgRNA CRISPR Lentivector set (Mouse)
K3365901	ABM	3 x 1.0 ug	EUR 339

UBE2B sgRNA CRISPR Lentivector set (Human)
K2570401	ABM	3 x 1.0 ug	EUR 339

Monoclonal UBE2B Antibody (monoclonal) (M06), Clone: 4C3
APR10639G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human UBE2B (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4C3. This antibody is applicable in WB, E

Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx004827	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
abx122398-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx141838	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
abx239164-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx241159	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 B (UBE2B) Antibody
20-abx241160	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ube2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7048302	ABM	1.0 ug DNA	EUR 154

Ube2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7048303	ABM	1.0 ug DNA	EUR 154

Ube2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7048304	ABM	1.0 ug DNA	EUR 154

Ube2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3365902	ABM	1.0 ug DNA	EUR 154

Ube2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3365903	ABM	1.0 ug DNA	EUR 154

Ube2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3365904	ABM	1.0 ug DNA	EUR 154

UBE2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2570402	ABM	1.0 ug DNA	EUR 154

UBE2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2570403	ABM	1.0 ug DNA	EUR 154

UBE2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2570404	ABM	1.0 ug DNA	EUR 154

UBE2B Protein Vector (Mouse) (pPB-C-His)
PV243494	ABM	500 ng	EUR 603

UBE2B Protein Vector (Mouse) (pPB-N-His)
PV243495	ABM	500 ng	EUR 603

UBE2B Protein Vector (Mouse) (pPM-C-HA)
PV243496	ABM	500 ng	EUR 603

UBE2B Protein Vector (Mouse) (pPM-C-His)
PV243497	ABM	500 ng	EUR 603

UBE2B Protein Vector (Rat) (pPB-C-His)
PV314030	ABM	500 ng	EUR 603

UBE2B Protein Vector (Rat) (pPB-N-His)
PV314031	ABM	500 ng	EUR 603

UBE2B Protein Vector (Rat) (pPM-C-HA)
PV314032	ABM	500 ng	EUR 603

UBE2B Protein Vector (Rat) (pPM-C-His)
PV314033	ABM	500 ng	EUR 603

UBE2B Protein Vector (Human) (pPB-C-His)
PV044893	ABM	500 ng	EUR 329

UBE2B Protein Vector (Human) (pPB-N-His)
PV044894	ABM	500 ng	EUR 329

UBE2B Protein Vector (Human) (pPM-C-HA)
PV044895	ABM	500 ng	EUR 329

UBE2B Protein Vector (Human) (pPM-C-His)
PV044896	ABM	500 ng	EUR 329

Recombinant Human UBE2B Protein, His, E.coli-10ug
QP13853-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human UBE2B Protein, His, E.coli-1mg
QP13853-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human UBE2B Protein, His, E.coli-2ug
QP13853-2ug	EnQuireBio	2ug	EUR 155

Ube2b 3'UTR Luciferase Stable Cell Line
TU121449	ABM	1.0 ml	Ask for price