ada assay

ADA Assay Kit

abx098403-Hitachi7060R190ml2R290ml1 Hitachi 7060; R1: 90ml×2 R2: 90ml×1
EUR 739.00
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R140ml4R220ml4 Hitachi 7170; R1: 40ml×4 R2: 20ml×4
EUR 801.00
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R160ml4R260ml2 Hitachi 7170; R1: 60ml×4 R2: 60ml×2
EUR 911.00
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Toshiba40R150ml4R250ml2 Toshiba 40; R1: 50ml×4 R2: 50ml×2
EUR 786.00
  • Shipped within 5-12 working days.

Human Adenosine Deaminase (ADA) ELISA Kit

DL-ADA-Hu-192 1 kit of 192 tests
EUR 1103.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Adenosine Deaminase (ADA)

Human Adenosine Deaminase (ADA) ELISA Kit

DL-ADA-Hu-48 1 kit of 48 tests
EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Adenosine Deaminase (ADA)

Human Adenosine Deaminase (ADA) ELISA Kit

DL-ADA-Hu-96 1 kit of 96 tests
EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Adenosine Deaminase (ADA)

Human Adenosine Deaminase (ADA) ELISA Kit

DLR-ADA-Hu-48T 48T
EUR 498.00
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

DLR-ADA-Hu-96T 96T
EUR 647.00
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

RDR-ADA-Hu-48Tests 48 Tests
EUR 522.00

Human Adenosine Deaminase (ADA) ELISA Kit

RDR-ADA-Hu-96Tests 96 Tests
EUR 724.00

Human Adenosine Deaminase (ADA) ELISA Kit

RD-ADA-Hu-48Tests 48 Tests
EUR 500.00

Human Adenosine Deaminase (ADA) ELISA Kit

RD-ADA-Hu-96Tests 96 Tests
EUR 692.00

ADA

GM7835-100G 100 g
EUR 86.00

ADA

GM7835-250G 250 g
EUR 150.00

ADA

GM7835-25G 25 g
EUR 54.00

ADA

GM7835-500G 500 g
EUR 229.00

ADA Enzyme

20-abx072002
  • EUR 913.00
  • EUR 4170.00
  • EUR 328.00
  • 150 µg
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

ADA Enzyme

20-abx072003
  • EUR 913.00
  • EUR 4170.00
  • EUR 328.00
  • 150 µg
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

ADA buffer

AD0003 25g
EUR 64.79
  • Product category: Biochemicals/Biological Buffers/Common Buffers

ADA Antibody

1-CSB-PA001268EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADA. Recognizes ADA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ADA Antibody

1-CSB-PA776767
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADA. Recognizes ADA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ADA Antibody

1-CSB-PA240615
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADA. Recognizes ADA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

ADA Antibody

32121-100ul 100ul
EUR 252.00

ADA antibody

70R-5745 50 ug
EUR 467.00
Description: Rabbit polyclonal ADA antibody raised against the middle region of ADA

ADA antibody

70R-5862 50 ug
EUR 467.00
Description: Rabbit polyclonal ADA antibody raised against the N terminal of ADA

ADA siRNA

20-abx900178
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA siRNA

20-abx906796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA siRNA

20-abx906797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA Antibody

DF6184 200ul
EUR 304.00
Description: ADA Antibody detects endogenous levels of total ADA.

ADA Antibody

ABD6184 100 ug
EUR 438.00

anti-ADA

YF-PA10066 50 ug
EUR 363.00
Description: Mouse polyclonal to ADA

anti-ADA

YF-PA10067 100 ul
EUR 403.00
Description: Rabbit polyclonal to ADA

anti-ADA

YF-PA10068 100 ug
EUR 403.00
Description: Rabbit polyclonal to ADA

anti-ADA

YF-PA23174 50 ul
EUR 334.00
Description: Mouse polyclonal to ADA

ADA Enzyme (Recombinant)

20-abx073712
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADA Conjugated Antibody

C32121 100ul
EUR 397.00

ADA cloning plasmid

CSB-CL001268HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atggcccagacgcccgccttcgacaagcccaaagtagaactgcatgtccacctagacggatccatcaagcctgaaaccatcttatactatggcaggaggagagggatcgccctcccagctaacacagcagaggggctgctgaacgtcattggcatggacaagccgctcacccttc
  • Show more
Description: A cloning plasmid for the ADA gene.

ADA Blocking Peptide

33R-1257 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSK3B antibody, catalog no. 70R-2198

ADA Blocking Peptide

33R-1412 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADA antibody, catalog no. 70R-5745

ADA Polyclonal Antibody

A50009 100 µg
EUR 570.55
Description: The best epigenetics products

Human Recombinant ADA

6393-50
EUR 436.00

ADA Polyclonal Antibody

ABP57703-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of ADA from Human. This ADA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160

ADA Polyclonal Antibody

ABP57703-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of ADA from Human. This ADA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160

ADA Polyclonal Antibody

ABP57703-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of ADA from Human. This ADA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160

ADA Polyclonal Antibody

E-AB-10729-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat ADA for WB,IHC,ELISA applications.

ADA Polyclonal Antibody

E-AB-10729-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat ADA for WB,IHC,ELISA applications.

ADA Polyclonal Antibody

E-AB-10729-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat ADA for WB,IHC,ELISA applications.

ADA Blocking Peptide

DF6184-BP 1mg
EUR 195.00

ADA Rabbit pAb

A13910-100ul 100 ul
EUR 308.00