ADA Assay Kit

abx098403-Hitachi7170R140ml4R220ml4 Hitachi 7170; R1: 40ml×4 R2: 20ml×4
EUR 801
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R160ml4R260ml2 Hitachi 7170; R1: 60ml×4 R2: 60ml×2
EUR 911
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Toshiba40R150ml4R250ml2 Toshiba 40; R1: 50ml×4 R2: 50ml×2
EUR 786
  • Shipped within 5-12 working days.

ADA Assay Kit

abx090675-100tests 100 tests
EUR 237
  • Shipped within 5-10 working days.

Human Adenosine Deaminase (ADA) ELISA Kit

DLR-ADA-Hu-48T 48T
EUR 498
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

DLR-ADA-Hu-96T 96T
EUR 647
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

RD-ADA-Hu-48Tests 48 Tests
EUR 500

Human Adenosine Deaminase (ADA) ELISA Kit

RD-ADA-Hu-96Tests 96 Tests
EUR 692

Human Adenosine Deaminase (ADA) ELISA Kit

RDR-ADA-Hu-48Tests 48 Tests
EUR 522

Human Adenosine Deaminase (ADA) ELISA Kit

RDR-ADA-Hu-96Tests 96 Tests
EUR 724

Shikari (Q-ADA) Adalimumab (Humira)Free drug ELISA kit

ADA-FD-HUM 1x96-wells test plate
EUR 809.75
Description: Enzyme Immunoassay for detection of freeAdalimumab (Humira) in human serum and plasma samples.


GM7835-100G 100 g
EUR 86


GM7835-250G 250 g
EUR 150


GM7835-25G 25 g
EUR 54


GM7835-500G 500 g
EUR 229

ADA Antibody

32121-100ul 100ul
EUR 252

ADA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADA. Recognizes ADA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ADA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADA. Recognizes ADA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ADA Antibody

DF6184 200ul
EUR 304
Description: ADA Antibody detects endogenous levels of total ADA.

ADA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADA. Recognizes ADA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

ADA antibody

70R-5745 50 ug
EUR 467
Description: Rabbit polyclonal ADA antibody raised against the middle region of ADA

ADA antibody

70R-5862 50 ug
EUR 467
Description: Rabbit polyclonal ADA antibody raised against the N terminal of ADA

ADA Enzyme

  • EUR 913.00
  • EUR 4170.00
  • EUR 328.00
  • 150 µg
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

ADA Enzyme

  • EUR 913.00
  • EUR 4170.00
  • EUR 328.00
  • 150 µg
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA Antibody

ABD6184 100 ug
EUR 438


YF-PA10066 50 ug
EUR 363
Description: Mouse polyclonal to ADA


YF-PA10067 100 ul
EUR 403
Description: Rabbit polyclonal to ADA


YF-PA10068 100 ug
EUR 403
Description: Rabbit polyclonal to ADA


YF-PA23174 50 ul
EUR 334
Description: Mouse polyclonal to ADA

ADA buffer

AD0003 25g
EUR 64.79
  • Product category: Biochemicals/Biological Buffers/Common Buffers

ADA Rabbit pAb

A1019-100ul 100 ul
EUR 308

ADA Rabbit pAb

A1019-200ul 200 ul
EUR 459

ADA Rabbit pAb

A1019-20ul 20 ul
EUR 183

ADA Rabbit pAb

A1019-50ul 50 ul
EUR 223

ADA Rabbit pAb

A13910-100ul 100 ul
EUR 308

ADA Rabbit pAb

A13910-200ul 200 ul
EUR 459

ADA Rabbit pAb

A13910-20ul 20 ul
EUR 183

ADA Rabbit pAb

A13910-50ul 50 ul
EUR 223

ADA Blocking Peptide

33R-1257 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSK3B antibody, catalog no. 70R-2198

ADA Blocking Peptide

33R-1412 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADA antibody, catalog no. 70R-5745

Human Recombinant ADA

EUR 436

ADA Blocking Peptide

DF6184-BP 1mg
EUR 195

Anti-ADA Antibody

A00866-1 100ug/vial
EUR 334

Anti-ADA Antibody

A00866-2 100ug/vial
EUR 334

ADA Enzyme (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADA Conjugated Antibody

C32121 100ul
EUR 397

ADA cloning plasmid

CSB-CL001268HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atggcccagacgcccgccttcgacaagcccaaagtagaactgcatgtccacctagacggatccatcaagcctgaaaccatcttatactatggcaggaggagagggatcgccctcccagctaacacagcagaggggctgctgaacgtcattggcatggacaagccgctcacccttc
  • Show more
Description: A cloning plasmid for the ADA gene.