  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL35A Antibody

ABD13240 100 ug
EUR 438.00

RPL35A Antibody

ABD9131 100 ug
EUR 438.00

RPL35A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL35A. Recognizes RPL35A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPL35A Antibody

DF9131 200ul
EUR 304.00
Description: RPL35A Antibody detects endogenous levels of total RPL35A.

RPL35A Antibody

43356-100ul 100ul
EUR 252.00

RPL35A Antibody

abx147788-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.


YF-PA24612 50 ul
EUR 334.00
Description: Mouse polyclonal to RPL35A

RPL35A Polyclonal Antibody

A54938 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL35A Rabbit pAb

A17938-100ul 100 ul
EUR 308.00

RPL35A Rabbit pAb

A17938-200ul 200 ul
EUR 459.00

RPL35A Rabbit pAb

A17938-20ul 20 ul
EUR 183.00

RPL35A Rabbit pAb

A17938-50ul 50 ul
EUR 223.00

RPL35A Blocking Peptide

DF9131-BP 1mg
EUR 195.00

Human RPL35A Antibody

32788-05111 150 ug
EUR 261.00

RPL35A cloning plasmid

CSB-CL020248HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtctggaaggctgtggtccaaggccatttttgctggctataagcggggtctccggaaccaaagggagcacacagctcttcttaaaattgaaggtgtttacgcccgagatgaaacagaattctatttgggcaagagatgcgcttatgtatataaagcaaagaacaacacagtcac
  • Show more
Description: A cloning plasmid for the RPL35A gene.

RPL35A Conjugated Antibody

C43356 100ul
EUR 397.00


PVT13292 2 ug
EUR 391.00

Anti-RPL35A antibody

STJ119922 100 µl
EUR 277.00

Human RPL35A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL35A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL35A protein (His tag)

80R-3041 100 ug
EUR 327.00
Description: Purified recombinant RPL35A protein (His tag)

RPL35A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL35A. Recognizes RPL35A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL35A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL35A. Recognizes RPL35A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL35A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL35A. Recognizes RPL35A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RPL35A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL35A Recombinant Protein (Rat)

RP226679 100 ug Ask for price

RPL35A Recombinant Protein (Human)

RP026983 100 ug Ask for price

RPL35A Recombinant Protein (Mouse)

RP169058 100 ug Ask for price

RPL35A Recombinant Protein (Mouse)

RP169061 100 ug Ask for price

RPL35A Recombinant Protein (Mouse)

RP169064 100 ug Ask for price

RPL35A Polyclonal Antibody, Biotin Conjugated

A54935 100 µg
EUR 570.55
Description: The best epigenetics products

RPL35A Polyclonal Antibody, FITC Conjugated

A54936 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL35A Polyclonal Antibody, HRP Conjugated

A54937 100 µg
EUR 570.55
Description: fast delivery possible

Human RPL35A Antibody (Biotin Conjugate)

32788-05121 150 ug
EUR 369.00

Rpl35a ORF Vector (Mouse) (pORF)

ORF056354 1.0 ug DNA
EUR 506.00

Rpl35a ORF Vector (Mouse) (pORF)

ORF056355 1.0 ug DNA
EUR 506.00

Rpl35a ORF Vector (Mouse) (pORF)

ORF056356 1.0 ug DNA
EUR 506.00

Rpl35a ORF Vector (Rat) (pORF)

ORF075561 1.0 ug DNA
EUR 506.00

RPL35A ORF Vector (Human) (pORF)

ORF008995 1.0 ug DNA
EUR 95.00

Human RPL35A AssayLite Antibody (FITC Conjugate)

32788-05141 150 ug
EUR 428.00

Human RPL35A AssayLite Antibody (RPE Conjugate)

32788-05151 150 ug
EUR 428.00

Human RPL35A AssayLite Antibody (APC Conjugate)

32788-05161 150 ug
EUR 428.00

Human RPL35A AssayLite Antibody (PerCP Conjugate)

32788-05171 150 ug
EUR 471.00

Human 60S ribosomal protein L35a (RPL35A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L35a(RPL35A) expressed in E.coli

60S Ribosomal Protein L35a (RPL35A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL35A sgRNA CRISPR Lentivector set (Human)

K1973901 3 x 1.0 ug
EUR 339.00

Rpl35a sgRNA CRISPR Lentivector set (Mouse)

K4548101 3 x 1.0 ug
EUR 339.00

Rpl35a sgRNA CRISPR Lentivector set (Rat)

K6893801 3 x 1.0 ug
EUR 339.00

RPL35A Ribosomal Protein L35A Human Recombinant Protein

PROTP18077 Regular: 20ug
EUR 317.00
Description: RPL35A Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.9kDa.;RPL35A is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL35A Protein Vector (Human) (pPB-C-His)

PV035977 500 ng
EUR 329.00

RPL35A Protein Vector (Human) (pPB-N-His)

PV035978 500 ng
EUR 329.00

RPL35A Protein Vector (Human) (pPM-C-HA)

PV035979 500 ng
EUR 329.00

RPL35A Protein Vector (Human) (pPM-C-His)

PV035980 500 ng
EUR 329.00

RPL35A sgRNA CRISPR Lentivector (Human) (Target 1)

K1973902 1.0 ug DNA
EUR 154.00

RPL35A sgRNA CRISPR Lentivector (Human) (Target 2)

K1973903 1.0 ug DNA
EUR 154.00

RPL35A sgRNA CRISPR Lentivector (Human) (Target 3)

K1973904 1.0 ug DNA
EUR 154.00

Rpl35a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4548102 1.0 ug DNA
EUR 154.00

Rpl35a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4548103 1.0 ug DNA
EUR 154.00

Rpl35a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4548104 1.0 ug DNA
EUR 154.00

Rpl35a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6893802 1.0 ug DNA
EUR 154.00

Rpl35a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6893803 1.0 ug DNA
EUR 154.00

Rpl35a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6893804 1.0 ug DNA
EUR 154.00

RPL35A Protein Vector (Mouse) (pPB-C-His)

PV225414 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPB-N-His)

PV225415 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPM-C-HA)

PV225416 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPM-C-His)

PV225417 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPB-C-His)

PV225418 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPB-N-His)

PV225419 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPM-C-HA)

PV225420 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPM-C-His)

PV225421 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPB-C-His)

PV225422 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPB-N-His)

PV225423 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPM-C-HA)

PV225424 500 ng
EUR 603.00

RPL35A Protein Vector (Mouse) (pPM-C-His)

PV225425 500 ng
EUR 603.00

RPL35A 3'UTR Luciferase Stable Cell Line

TU021418 1.0 ml
EUR 1394.00

RPL35A Protein Vector (Rat) (pPB-C-His)

PV302242 500 ng
EUR 603.00

RPL35A Protein Vector (Rat) (pPB-N-His)

PV302243 500 ng
EUR 603.00

RPL35A Protein Vector (Rat) (pPM-C-HA)

PV302244 500 ng
EUR 603.00

RPL35A Protein Vector (Rat) (pPM-C-His)

PV302245 500 ng
EUR 603.00

RPL35A 3'UTR GFP Stable Cell Line

TU071418 1.0 ml
EUR 1394.00

Rpl35a 3'UTR Luciferase Stable Cell Line

TU219642 1.0 ml Ask for price

Rpl35a 3'UTR GFP Stable Cell Line

TU269642 1.0 ml Ask for price