NSMCE4A

NSMCE4A cloning plasmid

CSB-CL882137HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgtctggggacagcagcggccgcgggccagagggccggggccggggccgcgacccgcatcgggatcgcacccgctcccgctcccgctcgcggtcccctttgtcgcccaggtcccgccgcggctctgcgcgggagcgcagagaggccccagagcgcccgagcctggaggacacaga
  • Show more
Description: A cloning plasmid for the NSMCE4A gene.

Human NSMCE4A shRNA Plasmid

20-abx960212
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine NSMCE4A ELISA KIT

ELI-15033b 96 Tests
EUR 928.00

Human NSMCE4A ELISA KIT

ELI-44860h 96 Tests
EUR 824.00

NSMCE4A Recombinant Protein (Rat)

RP214622 100 ug Ask for price

NSMCE4A Recombinant Protein (Human)

RP021703 100 ug Ask for price

NSMCE4A Recombinant Protein (Mouse)

RP155150 100 ug Ask for price

Nsmce4a ORF Vector (Rat) (pORF)

ORF071542 1.0 ug DNA
EUR 506.00

Nsmce4a ORF Vector (Mouse) (pORF)

ORF051718 1.0 ug DNA
EUR 506.00

NSMCE4A ORF Vector (Human) (pORF)

ORF007235 1.0 ug DNA
EUR 95.00

Polyclonal NSMCE4A Antibody - C-terminal region

APR01814G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NSMCE4A - C-terminal region. This antibody is tested and proven to work in the following applications:

NSMCE4A sgRNA CRISPR Lentivector set (Human)

K1457901 3 x 1.0 ug
EUR 339.00

Nsmce4a sgRNA CRISPR Lentivector set (Mouse)

K3063601 3 x 1.0 ug
EUR 339.00

Nsmce4a sgRNA CRISPR Lentivector set (Rat)

K6152601 3 x 1.0 ug
EUR 339.00

NSMCE4A Protein Vector (Human) (pPB-C-His)

PV028937 500 ng
EUR 329.00

NSMCE4A Protein Vector (Human) (pPB-N-His)

PV028938 500 ng
EUR 329.00

NSMCE4A Protein Vector (Human) (pPM-C-HA)

PV028939 500 ng
EUR 329.00

NSMCE4A Protein Vector (Human) (pPM-C-His)

PV028940 500 ng
EUR 329.00

NSMCE4A sgRNA CRISPR Lentivector (Human) (Target 1)

K1457902 1.0 ug DNA
EUR 154.00

NSMCE4A sgRNA CRISPR Lentivector (Human) (Target 2)

K1457903 1.0 ug DNA
EUR 154.00

NSMCE4A sgRNA CRISPR Lentivector (Human) (Target 3)

K1457904 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3063602 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3063603 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3063604 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6152602 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6152603 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6152604 1.0 ug DNA
EUR 154.00

NSMCE4A 3'UTR Luciferase Stable Cell Line

TU016000 1.0 ml
EUR 1394.00

NSMCE4A 3'UTR GFP Stable Cell Line

TU066000 1.0 ml
EUR 1394.00

NSMCE4A Protein Vector (Mouse) (pPB-C-His)

PV206870 500 ng
EUR 603.00

NSMCE4A Protein Vector (Mouse) (pPB-N-His)

PV206871 500 ng
EUR 603.00

NSMCE4A Protein Vector (Mouse) (pPM-C-HA)

PV206872 500 ng
EUR 603.00

NSMCE4A Protein Vector (Mouse) (pPM-C-His)

PV206873 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPB-C-His)

PV286166 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPB-N-His)

PV286167 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPM-C-HA)

PV286168 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPM-C-His)

PV286169 500 ng
EUR 603.00

Nsmce4a 3'UTR GFP Stable Cell Line

TU164352 1.0 ml Ask for price

Nsmce4a 3'UTR GFP Stable Cell Line

TU264220 1.0 ml Ask for price

Nsmce4a 3'UTR Luciferase Stable Cell Line

TU214220 1.0 ml Ask for price

Nsmce4a 3'UTR Luciferase Stable Cell Line

TU114352 1.0 ml Ask for price

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1457905 3 x 1.0 ug
EUR 376.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3063605 3 x 1.0 ug
EUR 376.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6152605 3 x 1.0 ug
EUR 376.00

Non-Structural Maintenance of Chromosomes Element 4 Homolog A (NSMCE4A) Antibody

abx122125-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1457906 1.0 ug DNA
EUR 167.00

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1457907 1.0 ug DNA
EUR 167.00

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1457908 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3063606 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3063607 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3063608 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6152606 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6152607 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6152608 1.0 ug DNA
EUR 167.00