NEU4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

NEU4 Antibody

DF12123 200ul
EUR 304.00
Description: NEU4 antibody detects endogenous levels of NEU4.

NEU4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NEU4 antibody

70R-4135 50 ug
EUR 467.00
Description: Rabbit polyclonal NEU4 antibody raised against the N terminal of NEU4


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NEU4 Polyclonal Antibody

30638-100ul 100ul
EUR 252.00

NEU4 Polyclonal Antibody

30638-50ul 50ul
EUR 187.00

NEU4 Blocking Peptide

33R-9097 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEU4 antibody, catalog no. 70R-4135

NEU4 Blocking Peptide

DF12123-BP 1mg
EUR 195.00

NEU4 cloning plasmid

CSB-CL848831HU1-10ug 10ug
EUR 304.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 693
  • Sequence: atgctggcacgggcaccgtcttcctcttcttcatcgcggtgctgggccacacgcctgaggccgtgcagatcgccacgggaaggaacgccgcgcgcctctgctgtgtggccagccgtgacgccggcctctcgtggggcagcgcccgggacctcaccgaggaggccatcggtggtgcc
  • Show more
Description: A cloning plasmid for the NEU4 gene.

NEU4 cloning plasmid

CSB-CL848831HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: atgatgagctctgcagccttcccaaggtggctgagcatgggggtccctcgtaccccttcacggacagtgctcttcgagcgggagaggacgggcctgacctaccgcgtgccctcgctgctccccgtgccccccgggcccaccctgctggcctttgtggagcagcggctcagccctg
  • Show more
Description: A cloning plasmid for the NEU4 gene.

NEU4 Polyclonal Antibody

A70123 100 ?g
EUR 628.55
Description: kits suitable for this type of research

NEU4 Rabbit pAb

A5141-100ul 100 ul
EUR 308.00

NEU4 Rabbit pAb

A5141-200ul 200 ul
EUR 459.00

NEU4 Rabbit pAb

A5141-20ul 20 ul
EUR 183.00

NEU4 Rabbit pAb

A5141-50ul 50 ul
EUR 223.00

anti- NEU4 antibody

FNab05668 100µg
EUR 585.00
  • Immunogen: sialidase 4
  • Uniprot ID: Q8WWR8
  • Gene ID: 129807
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against NEU4

Anti-NEU4 antibody

PAab05668 100 ug
EUR 412.00


PVT14097 2 ug
EUR 391.00

Anti-NEU4 antibody

STJ27123 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to a family of glycohydrolytic enzymes, which remove terminal sialic acid residues from various sialo derivatives, such as glycoproteins, glycolipids, oligosaccharides, and gangliosides. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

NEU4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NEU4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NEU4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Sialidase 4 (NEU4) Antibody

abx025695-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody

abx025695-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.


EF001183 96 Tests
EUR 689.00

Human NEU4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NEU4 Polyclonal Conjugated Antibody

C30638 100ul
EUR 397.00

Neuraminidase 4 (NEU4) Antibody

abx235668-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Sialidase 4 (NEU4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Mouse NEU4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NEU4 Recombinant Protein (Human)

RP021088 100 ug Ask for price

NEU4 Recombinant Protein (Human)

RP041620 100 ug Ask for price

NEU4 Recombinant Protein (Mouse)

RP153746 100 ug Ask for price

NEU4 Recombinant Protein (Rat)

RP213719 100 ug Ask for price

Sialidase 4 (NEU4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NEU4 Polyclonal Antibody, HRP Conjugated

A70124 100 ?g
EUR 628.55
Description: fast delivery possible

NEU4 Polyclonal Antibody, FITC Conjugated

A70125 100 ?g
EUR 628.55
Description: reagents widely cited

NEU4 Polyclonal Antibody, Biotin Conjugated

A70126 100 ?g
EUR 628.55
Description: Ask the seller for details

Neu4 ORF Vector (Rat) (pORF)

ORF071241 1.0 ug DNA
EUR 506.00

NEU4 ORF Vector (Human) (pORF)

ORF013874 1.0 ug DNA
EUR 354.00

NEU4 ORF Vector (Human) (pORF)

ORF007030 1.0 ug DNA
EUR 95.00

Neu4 ORF Vector (Mouse) (pORF)

ORF051250 1.0 ug DNA
EUR 506.00

Mouse Sialidase- 4, Neu4 ELISA KIT

ELI-13819m 96 Tests
EUR 865.00

Human Sialidase- 4, NEU4 ELISA KIT

ELI-16463h 96 Tests
EUR 824.00

Neu4 sgRNA CRISPR Lentivector set (Rat)

K6573801 3 x 1.0 ug
EUR 339.00

Neu4 sgRNA CRISPR Lentivector set (Mouse)

K3003401 3 x 1.0 ug
EUR 339.00

Neu4 sgRNA CRISPR Lentivector set (Mouse)

K3613601 3 x 1.0 ug
EUR 339.00

NEU4 sgRNA CRISPR Lentivector set (Human)

K1418501 3 x 1.0 ug
EUR 339.00

Neu4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6573802 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6573803 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6573804 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3003402 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3003403 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3003404 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3613602 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3613603 1.0 ug DNA
EUR 154.00

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3613604 1.0 ug DNA
EUR 154.00

NEU4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1418502 1.0 ug DNA
EUR 154.00

NEU4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1418503 1.0 ug DNA
EUR 154.00

NEU4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1418504 1.0 ug DNA
EUR 154.00

NEU4 Protein Vector (Mouse) (pPB-C-His)

PV204998 500 ng
EUR 603.00

NEU4 Protein Vector (Mouse) (pPB-N-His)

PV204999 500 ng
EUR 603.00

NEU4 Protein Vector (Mouse) (pPM-C-HA)

PV205000 500 ng
EUR 603.00

NEU4 Protein Vector (Mouse) (pPM-C-His)

PV205001 500 ng
EUR 603.00

NEU4 Protein Vector (Rat) (pPB-C-His)

PV284962 500 ng
EUR 603.00

NEU4 Protein Vector (Rat) (pPB-N-His)

PV284963 500 ng
EUR 603.00

NEU4 Protein Vector (Rat) (pPM-C-HA)

PV284964 500 ng
EUR 603.00

NEU4 Protein Vector (Rat) (pPM-C-His)

PV284965 500 ng
EUR 603.00

NEU4 Protein Vector (Human) (pPB-C-His)

PV028117 500 ng
EUR 329.00

NEU4 Protein Vector (Human) (pPB-N-His)

PV028118 500 ng
EUR 329.00

NEU4 Protein Vector (Human) (pPM-C-HA)

PV028119 500 ng
EUR 329.00

NEU4 Protein Vector (Human) (pPM-C-His)

PV028120 500 ng
EUR 329.00

NEU4 Protein Vector (Human) (pPB-C-His)

PV055493 500 ng
EUR 481.00

NEU4 Protein Vector (Human) (pPB-N-His)

PV055494 500 ng
EUR 481.00

NEU4 Protein Vector (Human) (pPM-C-HA)

PV055495 500 ng
EUR 481.00

NEU4 Protein Vector (Human) (pPM-C-His)

PV055496 500 ng
EUR 481.00

Neu4 3'UTR Luciferase Stable Cell Line

TU114008 1.0 ml Ask for price

Neu4 3'UTR GFP Stable Cell Line

TU164008 1.0 ml Ask for price

Neu4 3'UTR Luciferase Stable Cell Line

TU213903 1.0 ml Ask for price

Neu4 3'UTR GFP Stable Cell Line

TU263903 1.0 ml Ask for price

NEU4 3'UTR GFP Stable Cell Line

TU065593 1.0 ml
EUR 1521.00

NEU4 3'UTR Luciferase Stable Cell Line

TU015593 1.0 ml
EUR 1521.00

NEU4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702639 1.0 ug DNA
EUR 450.00

NEU4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702643 1.0 ug DNA
EUR 450.00

NEU4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702644 1.0 ug DNA
EUR 450.00

Neu4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6573805 3 x 1.0 ug
EUR 376.00

Neu4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3003405 3 x 1.0 ug
EUR 376.00

Neu4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3613605 3 x 1.0 ug
EUR 376.00

NEU4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1418505 3 x 1.0 ug
EUR 376.00