Gemini Genomics

NGS Sequencing


Vesicle-Trafficking Protein SEC22a (SEC22A) Antibody
abx122013-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Vesicle-Trafficking Protein SEC22a (SEC22A) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEC22A Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22A. Recognizes SEC22A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
Mouse Vesicle- trafficking protein SEC22a, Sec22a ELISA KIT
ELI-53030m 96 Tests
EUR 865
Human Vesicle- trafficking protein SEC22a, SEC22A ELISA KIT
ELI-40852h 96 Tests
EUR 824
SEC22A Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC22A Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC22A Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC22A Polyclonal Antibody
A60834 100 µg
EUR 570.55
Description: kits suitable for this type of research
SEC22A cloning plasmid
CSB-CL856954HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 924
  • Sequence: atgtctatgattttatctgcctcagtcattcgtgtcagagatggactgccactttctgcttctactgattatgaacaaagcacaggaatgcaggagtgcagaaagtattttaaaatgctttcgaggaaacttgctcaacttcctgatagatgtacactgaaaactggacattataa
  • Show more
Description: A cloning plasmid for the SEC22A gene.
PVT12610 2 ug
EUR 391
Anti-SEC22A antibody
STJ13100338 100 µl
EUR 427
Rat SEC22A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SEC22A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SEC22A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEC22A Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22A. Recognizes SEC22A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEC22A Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22A. Recognizes SEC22A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEC22A Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22A. Recognizes SEC22A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SEC22A Polyclonal Antibody, Biotin Conjugated
A60835 100 µg
EUR 570.55
Description: fast delivery possible
SEC22A Polyclonal Antibody, FITC Conjugated
A60836 100 µg
EUR 570.55
Description: reagents widely cited
SEC22A Polyclonal Antibody, HRP Conjugated
A60837 100 µg
EUR 570.55
Description: Ask the seller for details
SEC22A ORF Vector (Human) (pORF)
ORF009296 1.0 ug DNA
EUR 95
Sec22a ORF Vector (Mouse) (pORF)
ORF056847 1.0 ug DNA
EUR 506
Sec22a ORF Vector (Rat) (pORF)
ORF075961 1.0 ug DNA
EUR 506
SEC22A sgRNA CRISPR Lentivector set (Human)
K2112901 3 x 1.0 ug
EUR 339
Sec22a sgRNA CRISPR Lentivector set (Mouse)
K3136101 3 x 1.0 ug
EUR 339
Sec22a sgRNA CRISPR Lentivector set (Rat)
K6983001 3 x 1.0 ug
EUR 339
SEC22A sgRNA CRISPR Lentivector (Human) (Target 1)
K2112902 1.0 ug DNA
EUR 154
SEC22A sgRNA CRISPR Lentivector (Human) (Target 2)
K2112903 1.0 ug DNA
EUR 154
SEC22A sgRNA CRISPR Lentivector (Human) (Target 3)
K2112904 1.0 ug DNA
EUR 154
Sec22a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3136102 1.0 ug DNA
EUR 154
Sec22a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3136103 1.0 ug DNA
EUR 154
Sec22a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3136104 1.0 ug DNA
EUR 154
Sec22a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6983002 1.0 ug DNA
EUR 154
Sec22a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6983003 1.0 ug DNA
EUR 154
Sec22a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6983004 1.0 ug DNA
EUR 154
SEC22A Protein Vector (Human) (pPB-C-His)
PV037181 500 ng
EUR 329
SEC22A Protein Vector (Human) (pPB-N-His)
PV037182 500 ng
EUR 329
SEC22A Protein Vector (Human) (pPM-C-HA)
PV037183 500 ng
EUR 329
SEC22A Protein Vector (Human) (pPM-C-His)
PV037184 500 ng
EUR 329
SEC22A Protein Vector (Rat) (pPB-C-His)
PV303842 500 ng
EUR 603
SEC22A Protein Vector (Rat) (pPB-N-His)
PV303843 500 ng
EUR 603
SEC22A Protein Vector (Rat) (pPM-C-HA)
PV303844 500 ng
EUR 603
SEC22A Protein Vector (Rat) (pPM-C-His)
PV303845 500 ng
EUR 603
SEC22A Protein Vector (Mouse) (pPB-C-His)
PV227386 500 ng
EUR 603
SEC22A Protein Vector (Mouse) (pPB-N-His)
PV227387 500 ng
EUR 603
SEC22A Protein Vector (Mouse) (pPM-C-HA)
PV227388 500 ng
EUR 603
SEC22A Protein Vector (Mouse) (pPM-C-His)
PV227389 500 ng
EUR 603
Sec22a 3'UTR GFP Stable Cell Line
TU168494 1.0 ml Ask for price
SEC22A 3'UTR Luciferase Stable Cell Line
TU022832 1.0 ml
EUR 1521
Sec22a 3'UTR Luciferase Stable Cell Line
TU118494 1.0 ml Ask for price
SEC22A 3'UTR GFP Stable Cell Line
TU072832 1.0 ml
EUR 1521
Sec22a 3'UTR Luciferase Stable Cell Line
TU220057 1.0 ml Ask for price
Sec22a 3'UTR GFP Stable Cell Line
TU270057 1.0 ml Ask for price
SEC22A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690853 1.0 ug DNA
EUR 514
SEC22A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690857 1.0 ug DNA
EUR 514
SEC22A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690858 1.0 ug DNA
EUR 514
SEC22A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2112905 3 x 1.0 ug
EUR 376
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3136105 3 x 1.0 ug
EUR 376
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6983005 3 x 1.0 ug
EUR 376
SEC22A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2112906 1.0 ug DNA
EUR 167
SEC22A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2112907 1.0 ug DNA
EUR 167
SEC22A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2112908 1.0 ug DNA
EUR 167
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3136106 1.0 ug DNA
EUR 167
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3136107 1.0 ug DNA
EUR 167
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3136108 1.0 ug DNA
EUR 167
SEC22A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV690854 1.0 ug DNA
EUR 514
SEC22A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV690855 1.0 ug DNA
EUR 572
SEC22A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV690856 1.0 ug DNA
EUR 572
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6983006 1.0 ug DNA
EUR 167
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6983007 1.0 ug DNA
EUR 167
Sec22a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6983008 1.0 ug DNA
EUR 167