PSMB3 siRNA

20-abx904312
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB3 siRNA

20-abx930146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB3 siRNA

20-abx930147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB3 antibody

70R-2348 50 ug
EUR 467
Description: Rabbit polyclonal PSMB3 antibody

PSMB3 antibody

70R-19584 50 ul
EUR 435
Description: Rabbit polyclonal PSMB3 antibody

PSMB3 Antibody

1-CSB-PA018880ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB3. Recognizes PSMB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSMB3 Antibody

1-CSB-PA018880GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMB3. Recognizes PSMB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-PSMB3

YF-PA14110 50 ug
EUR 363
Description: Mouse polyclonal to PSMB3

anti-PSMB3

YF-PA14111 50 ug
EUR 363
Description: Mouse polyclonal to PSMB3

anti-PSMB3

YF-PA24500 50 ul
EUR 334
Description: Mouse polyclonal to PSMB3

PSMB3 cloning plasmid

CSB-CL018880HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtctattatgtcctataacggaggggccgtcatggccatgaaggggaagaactgtgtggccatcgctgcagacaggcgcttcgggatccaggcccagatggtgaccacggacttccagaagatctttcccatgggtgaccggctgtacatcggtctggccgggctcgccactga
  • Show more
Description: A cloning plasmid for the PSMB3 gene.

anti- PSMB3 antibody

FNab06872 100µg
EUR 505.25
  • Immunogen: proteasome(prosome, macropain) subunit, beta type, 3
  • Uniprot ID: P49720
  • Gene ID: 5691
  • Research Area: Metabolism
Description: Antibody raised against PSMB3

PSMB3 Rabbit pAb

A9947-100ul 100 ul
EUR 308

PSMB3 Rabbit pAb

A9947-200ul 200 ul
EUR 459

PSMB3 Rabbit pAb

A9947-20ul 20 ul
EUR 183

PSMB3 Rabbit pAb

A9947-50ul 50 ul
EUR 223

PSMB3 Blocking Peptide

33R-5230 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB3 antibody, catalog no. 70R-2348

PSMB3 Polyclonal Antibody

31780-100ul 100ul
EUR 252

PSMB3 Polyclonal Antibody

31780-50ul 50ul
EUR 187

Anti-PSMB3 antibody

PAab06872 100 ug
EUR 355

Anti-PSMB3 antibody

STJ72347 100 µg
EUR 359

Anti-PSMB3 antibody

STJ111988 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants

Polyclonal PSMB3 Antibody (Center)

APR04876G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB3 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal PSMB3 Antibody (Center)

APR06965G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB3 (Center). This antibody is tested and proven to work in the following applications:

PSMB3 Polyclonal Conjugated Antibody

C31780 100ul
EUR 397

Mouse PSMB3 shRNA Plasmid

20-abx973726
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMB3 shRNA Plasmid

20-abx985661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMB3 ELISA KIT|Human

EF002114 96 Tests
EUR 689

Human PSMB3 shRNA Plasmid

20-abx953838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMB3 protein (His tag)

80R-2047 100 ug
EUR 424
Description: Recombinant human PSMB3 protein (His tag)

PSMB3 Recombinant Protein (Human)

RP024925 100 ug Ask for price

PSMB3 Recombinant Protein (Rat)

RP222614 100 ug Ask for price

PSMB3 Recombinant Protein (Mouse)

RP165272 100 ug Ask for price

Polyclonal PSMB3 Antibody (internal region)

APG00696G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMB3 (internal region). This antibody is tested and proven to work in the following applications:

PSMB3 ORF Vector (Human) (pORF)

ORF008309 1.0 ug DNA
EUR 95

Psmb3 ORF Vector (Rat) (pORF)

ORF074206 1.0 ug DNA
EUR 506

Psmb3 ORF Vector (Mouse) (pORF)

ORF055092 1.0 ug DNA
EUR 506

PSMB3 sgRNA CRISPR Lentivector set (Human)

K1739601 3 x 1.0 ug
EUR 339

Psmb3 sgRNA CRISPR Lentivector set (Mouse)

K3926201 3 x 1.0 ug
EUR 339

Psmb3 sgRNA CRISPR Lentivector set (Rat)

K6846201 3 x 1.0 ug
EUR 339

Proteasome Subunit Beta Type 3 (PSMB3) Antibody

20-abx114771
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody

20-abx135867
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody

20-abx321835
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody

abx431842-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody

abx236872-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PSMB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1739602 1.0 ug DNA
EUR 154

PSMB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1739603 1.0 ug DNA
EUR 154

PSMB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1739604 1.0 ug DNA
EUR 154

Human Proteasome subunit beta type-3 (PSMB3)

1-CSB-EP018880HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasome subunit beta type-3(PSMB3) expressed in E.coli

Psmb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3926202 1.0 ug DNA
EUR 154

Psmb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3926203 1.0 ug DNA
EUR 154

Psmb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3926204 1.0 ug DNA
EUR 154

Psmb3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6846202 1.0 ug DNA
EUR 154

Psmb3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6846203 1.0 ug DNA
EUR 154

Psmb3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6846204 1.0 ug DNA
EUR 154