PSMB3 siRNA
20-abx904312
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMB3 siRNA
20-abx930146
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMB3 siRNA
20-abx930147
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMB3 antibody
70R-2348 50 ug
EUR 467.00
Description: Rabbit polyclonal PSMB3 antibody

PSMB3 antibody
70R-19584 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMB3 antibody

PSMB3 Antibody
1-CSB-PA018880ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB3. Recognizes PSMB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSMB3 Antibody
1-CSB-PA018880GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMB3. Recognizes PSMB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-PSMB3
YF-PA14110 50 ug
EUR 363.00
Description: Mouse polyclonal to PSMB3

anti-PSMB3
YF-PA14111 50 ug
EUR 363.00
Description: Mouse polyclonal to PSMB3

anti-PSMB3
YF-PA24500 50 ul
EUR 334.00
Description: Mouse polyclonal to PSMB3

PSMB3 cloning plasmid
CSB-CL018880HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtctattatgtcctataacggaggggccgtcatggccatgaaggggaagaactgtgtggccatcgctgcagacaggcgcttcgggatccaggcccagatggtgaccacggacttccagaagatctttcccatgggtgaccggctgtacatcggtctggccgggctcgccactga
  • Show more
Description: A cloning plasmid for the PSMB3 gene.

anti- PSMB3 antibody
FNab06872 100µg
EUR 505.25
  • Immunogen: proteasome(prosome, macropain) subunit, beta type, 3
  • Uniprot ID: P49720
  • Gene ID: 5691
  • Research Area: Metabolism
Description: Antibody raised against PSMB3

PSMB3 Rabbit pAb
A9947-100ul 100 ul
EUR 308.00

PSMB3 Rabbit pAb
A9947-200ul 200 ul
EUR 459.00

PSMB3 Rabbit pAb
A9947-20ul 20 ul
EUR 183.00

PSMB3 Rabbit pAb
A9947-50ul 50 ul
EUR 223.00

PSMB3 Blocking Peptide
33R-5230 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB3 antibody, catalog no. 70R-2348

PSMB3 Polyclonal Antibody
31780-100ul 100ul
EUR 252.00

PSMB3 Polyclonal Antibody
31780-50ul 50ul
EUR 187.00

Anti-PSMB3 antibody
PAab06872 100 ug
EUR 355.00

Anti-PSMB3 antibody
STJ72347 100 µg
EUR 359.00

Anti-PSMB3 antibody
STJ111988 100 µl
EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants

Polyclonal PSMB3 Antibody (Center)
APR04876G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB3 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal PSMB3 Antibody (Center)
APR06965G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB3 (Center). This antibody is tested and proven to work in the following applications:

PSMB3 Polyclonal Conjugated Antibody
C31780 100ul
EUR 397.00

Mouse PSMB3 shRNA Plasmid
20-abx973726
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat PSMB3 shRNA Plasmid
20-abx985661
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMB3 ELISA KIT|Human
EF002114 96 Tests
EUR 689.00

Human PSMB3 shRNA Plasmid
20-abx953838
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMB3 protein (His tag)
80R-2047 100 ug
EUR 424.00
Description: Recombinant human PSMB3 protein (His tag)

PSMB3 Recombinant Protein (Human)
RP024925 100 ug Ask for price

PSMB3 Recombinant Protein (Rat)
RP222614 100 ug Ask for price

PSMB3 Recombinant Protein (Mouse)
RP165272 100 ug Ask for price

Polyclonal PSMB3 Antibody (internal region)
APG00696G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMB3 (internal region). This antibody is tested and proven to work in the following applications:

PSMB3 ORF Vector (Human) (pORF)
ORF008309 1.0 ug DNA
EUR 95.00

Psmb3 ORF Vector (Rat) (pORF)
ORF074206 1.0 ug DNA
EUR 506.00

Psmb3 ORF Vector (Mouse) (pORF)
ORF055092 1.0 ug DNA
EUR 506.00

PSMB3 sgRNA CRISPR Lentivector set (Human)
K1739601 3 x 1.0 ug
EUR 339.00

Psmb3 sgRNA CRISPR Lentivector set (Mouse)
K3926201 3 x 1.0 ug
EUR 339.00

Psmb3 sgRNA CRISPR Lentivector set (Rat)
K6846201 3 x 1.0 ug
EUR 339.00

Proteasome Subunit Beta Type 3 (PSMB3) Antibody
20-abx114771
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody
20-abx135867
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody
20-abx321835
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody
abx431842-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Proteasome Subunit Beta Type 3 (PSMB3) Antibody
abx236872-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

PSMB3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1739602 1.0 ug DNA
EUR 154.00

PSMB3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1739603 1.0 ug DNA
EUR 154.00

PSMB3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1739604 1.0 ug DNA
EUR 154.00

Human Proteasome subunit beta type-3 (PSMB3)
1-CSB-EP018880HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 49.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasome subunit beta type-3(PSMB3) expressed in E.coli

Psmb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3926202 1.0 ug DNA
EUR 154.00

Psmb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3926203 1.0 ug DNA
EUR 154.00

Psmb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3926204 1.0 ug DNA
EUR 154.00

Psmb3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6846202 1.0 ug DNA
EUR 154.00

Psmb3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6846203 1.0 ug DNA
EUR 154.00

Psmb3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6846204 1.0 ug DNA
EUR 154.00