GPLD1

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
DLR-GPLD1-Hu-96T 96T
EUR 673
  • Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-48Tests 48 Tests
EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-96Tests 96 Tests
EUR 756

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RD-GPLD1-Hu-48Tests 48 Tests
EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RD-GPLD1-Hu-96Tests 96 Tests
EUR 723

GPLD1 antibody
39044-100ul 100ul
EUR 252

GPLD1 Antibody
DF9750 200ul
EUR 304
Description: GPLD1 Antibody detects endogenous levels of total GPLD1.

GPLD1 Antibody
1-CSB-PA009721LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GPLD1 siRNA
20-abx918384
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 siRNA
20-abx918385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 Antibody
ABD9750 100 ug
EUR 438

anti-GPLD1
YF-PA12100 50 ul
EUR 363
Description: Mouse polyclonal to GPLD1

anti-GPLD1
YF-PA12101 50 ug
EUR 363
Description: Mouse polyclonal to GPLD1

GPLD1 Blocking Peptide
DF9750-BP 1mg
EUR 195

GPLD1 Conjugated Antibody
C39044 100ul
EUR 397

GPLD1 cloning plasmid
CSB-CL009721HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc
  • Show more
Description: A cloning plasmid for the GPLD1 gene.

GPLD1 Rabbit pAb
A6612-100ul 100 ul
EUR 308

GPLD1 Rabbit pAb
A6612-200ul 200 ul
EUR 459

GPLD1 Rabbit pAb
A6612-20ul 20 ul
EUR 183

GPLD1 Rabbit pAb
A6612-50ul 50 ul
EUR 223

Anti-GPLD1 antibody
STJ28695 100 µl
EUR 277
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.

Human GPLD1 ELISA Kit
ELA-E13691h 96 Tests
EUR 824

GPLD1 ELISA KIT|Human
EF005585 96 Tests
EUR 689

Rat GPLD1 shRNA Plasmid
20-abx988490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPLD1 Antibody, HRP conjugated
1-CSB-PA009721LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPLD1 Antibody, FITC conjugated
1-CSB-PA009721LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPLD1 Antibody, Biotin conjugated
1-CSB-PA009721LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GPLD1 shRNA Plasmid
20-abx951887
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Gpld1 ORF Vector (Rat) (pORF)
ORF067750 1.0 ug DNA
EUR 506

GPLD1 ORF Vector (Human) (pORF)
ORF004583 1.0 ug DNA
EUR 95

Gpld1 ORF Vector (Mouse) (pORF)
ORF046446 1.0 ug DNA
EUR 506

GPLD1 ELISA Kit (Human) (OKAN05580)
OKAN05580 96 Wells
EUR 792
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

GPLD1 ELISA Kit (Human) (OKCD09132)
OKCD09132 96 Wells
EUR 975
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34ng/mL

GPLD1 ELISA Kit (Human) (OKEH02315)
OKEH02315 96 Wells
EUR 662
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL

GPLD1 ELISA Kit (Bovine) (OKEH03927)
OKEH03927 96 Wells
EUR 779
Description: Description of target: This protein hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans (GPI-anchor) thus releasing these proteins from the membrane.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.41 ng/mL

Polyclonal GPLD1 Antibody - N-terminal region
APR01631G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPLD1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx005070
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx129033
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx172649
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Gpld1 sgRNA CRISPR Lentivector set (Rat)
K7343301 3 x 1.0 ug
EUR 339

Gpld1 sgRNA CRISPR Lentivector set (Mouse)
K3398501 3 x 1.0 ug
EUR 339

GPLD1 sgRNA CRISPR Lentivector set (Human)
K0888101 3 x 1.0 ug
EUR 339

Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)
4-RPH975Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P80108
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein
20-abx168135
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7343302 1.0 ug DNA
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7343303 1.0 ug DNA
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7343304 1.0 ug DNA
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3398502 1.0 ug DNA
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3398503 1.0 ug DNA
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3398504 1.0 ug DNA
EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0888102 1.0 ug DNA
EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0888103 1.0 ug DNA
EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0888104 1.0 ug DNA
EUR 154

GPLD1 Protein Vector (Rat) (pPB-C-His)
PV270998 500 ng
EUR 1166

GPLD1 Protein Vector (Rat) (pPB-N-His)
PV270999 500 ng
EUR 1166

GPLD1 Protein Vector (Rat) (pPM-C-HA)
PV271000 500 ng
EUR 1166

GPLD1 Protein Vector (Rat) (pPM-C-His)
PV271001 500 ng
EUR 1166

GPLD1 Protein Vector (Mouse) (pPB-C-His)
PV185782 500 ng
EUR 1065

GPLD1 Protein Vector (Mouse) (pPB-N-His)
PV185783 500 ng
EUR 1065

GPLD1 Protein Vector (Mouse) (pPM-C-HA)
PV185784 500 ng
EUR 1065