MIA3

MIA3 siRNA
20-abx924116	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MIA3 siRNA
20-abx924117	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MIA3 antibody
23183-100ul	SAB	100ul	EUR 390

MIA3 antibody
70R-12614	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal MIA3 antibody

MIA3 Antibody
DF9622	Affbiotech	200ul	EUR 304
Description: MIA3 Antibody detects endogenous levels of total MIA3.

MIA3 Antibody
1-CSB-PA711448LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

anti- MIA3 antibody
FNab05174	FN Test	100µg	EUR 505.25
Immunogen: melanoma inhibitory activity family, member 3 Uniprot ID: Q5JRA6 Gene ID: 375056 Research Area: Signal Transduction
Description: Antibody raised against MIA3

MIA3 Polyclonal Antibody
ES9796-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MIA3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MIA3 Polyclonal Antibody
ES9796-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MIA3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MIA3 Polyclonal Antibody
ABP59272-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190 Applications tips:
Description: A polyclonal antibody for detection of MIA3 from Human, Mouse. This MIA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190

MIA3 Polyclonal Antibody
ABP59272-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190 Applications tips:
Description: A polyclonal antibody for detection of MIA3 from Human, Mouse. This MIA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190

MIA3 Polyclonal Antibody
ABP59272-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190 Applications tips:
Description: A polyclonal antibody for detection of MIA3 from Human, Mouse. This MIA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190

MIA3 Rabbit pAb
A15582-100ul	Abclonal	100 ul	EUR 308

MIA3 Rabbit pAb
A15582-200ul	Abclonal	200 ul	EUR 459

MIA3 Rabbit pAb
A15582-20ul	Abclonal	20 ul	EUR 183

MIA3 Rabbit pAb
A15582-50ul	Abclonal	50 ul	EUR 223

MIA3 Polyclonal Antibody
A65150	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

MIA3 Polyclonal Antibody
29354-100ul	SAB	100ul	EUR 252

MIA3 Polyclonal Antibody
29354-50ul	SAB	50ul	EUR 187

MIA3 Blocking Peptide
DF9622-BP	Affbiotech	1mg	EUR 195

MIA3 cloning plasmid
CSB-CL711448HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1386 Sequence: atgaaaaatcaaattaagcagatgatggatgtctctcggacacagactgcaatatcggtagttgaagaggatctaaagcttttacagcttaagctaagagcctccgtgtccactaaatgtaacctggaagaccaggtaaagaaattggaagatgaccgcaactcactacaagctg Show more
Description: A cloning plasmid for the MIA3 gene.

Anti-MIA3 antibody
PAab05174	Lifescience Market	100 ug	EUR 355

Anti-MIA3 antibody
STJ117777	St John's Laboratory	100 µl	EUR 277

Anti-MIA3 antibody
STJ190954	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MIA3

Polyclonal TANGO / MIA3 Antibody
AMM08085G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TANGO / MIA3 . This antibody is tested and proven to work in the following applications:

MIA3 Polyclonal Conjugated Antibody
C29354	SAB	100ul	EUR 397

Mouse MIA3 shRNA Plasmid
20-abx983690	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MIA3 ELISA KIT|Human
EF000783	Lifescience Market	96 Tests	EUR 689

Human MIA3 shRNA Plasmid
20-abx967653	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MIA3 Antibody, HRP conjugated
1-CSB-PA711448LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MIA3 Antibody, FITC conjugated
1-CSB-PA711448LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MIA3 Antibody, Biotin conjugated
1-CSB-PA711448LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MIA3 Polyclonal Antibody, HRP Conjugated
A65151	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

MIA3 Polyclonal Antibody, FITC Conjugated
A65152	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MIA3 Polyclonal Antibody, Biotin Conjugated
A65153	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MIA3 ORF Vector (Human) (pORF)
ORF006483	ABM	1.0 ug DNA	EUR 95

Mia3 ORF Vector (Mouse) (pORF)
ORF050194	ABM	1.0 ug DNA	EUR 1572

MIA3 ELISA Kit (Human) (OKCA01353)
OKCA01353	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Plays a role in the transport of cargos that are too large to fit into COPII-coated vesicles and require specific mechanisms to be incorporated into membrane-bound carriers and exported from the endoplasmic reticulum. This protein is required for collagen VII (COL7A1) secretion by loading COL7A1 into transport carriers. It may participate in cargo loading of COL7A1 at endoplasmic reticulum exit sites by binding to COPII coat subunits Sec23/24 and guiding SH3-bound COL7A1 into a growing carrier. Does not play a role in global protein secretion and is apparently specific to COL7A1 cargo loading. However, it may participate in secretion of other proteins in cells that do not secrete COL7A1. It is also specifically required for the secretion of lipoproteins by participating in their export from the endoplasmic reticulum (PubMed:27138255).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.11 ng/mL

MIA3 sgRNA CRISPR Lentivector set (Human)
K1300501	ABM	3 x 1.0 ug	EUR 339

Mia3 sgRNA CRISPR Lentivector set (Mouse)
K4410201	ABM	3 x 1.0 ug	EUR 339

MIA3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1300502	ABM	1.0 ug DNA	EUR 154

MIA3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1300503	ABM	1.0 ug DNA	EUR 154

MIA3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1300504	ABM	1.0 ug DNA	EUR 154

Mia3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4410202	ABM	1.0 ug DNA	EUR 154

Mia3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4410203	ABM	1.0 ug DNA	EUR 154

Mia3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4410204	ABM	1.0 ug DNA	EUR 154

MIA3 Protein Vector (Human) (pPB-C-His)
PV025929	ABM	500 ng	EUR 329

MIA3 Protein Vector (Human) (pPB-N-His)
PV025930	ABM	500 ng	EUR 329

MIA3 Protein Vector (Human) (pPM-C-HA)
PV025931	ABM	500 ng	EUR 329

MIA3 Protein Vector (Human) (pPM-C-His)
PV025932	ABM	500 ng	EUR 329

MIA3 Protein Vector (Mouse) (pPB-C-His)
PV200774	ABM	500 ng	EUR 3192

MIA3 Protein Vector (Mouse) (pPB-N-His)
PV200775	ABM	500 ng	EUR 3192

MIA3 Protein Vector (Mouse) (pPM-C-HA)
PV200776	ABM	500 ng	EUR 3192

MIA3 Protein Vector (Mouse) (pPM-C-His)
PV200777	ABM	500 ng	EUR 3192

Mia3 3'UTR GFP Stable Cell Line
TU163187	ABM	1.0 ml	Ask for price

MIA3 3'UTR Luciferase Stable Cell Line
TU013337	ABM	1.0 ml	EUR 2333

Mia3 3'UTR Luciferase Stable Cell Line
TU113187	ABM	1.0 ml	Ask for price

MIA3 3'UTR GFP Stable Cell Line
TU063337	ABM	1.0 ml	EUR 2333

Mouse Melanoma inhibitory activity protein 3, Mia3 ELISA KIT
ELI-14026m	Lifescience Market	96 Tests	EUR 865

Bovine Melanoma inhibitory activity protein 3, MIA3 ELISA KIT
ELI-19513b	Lifescience Market	96 Tests	EUR 928

Human Melanoma inhibitory activity protein 3, MIA3 ELISA KIT
ELI-20371h	Lifescience Market	96 Tests	EUR 824

MIA Family Member 3, ER Export Factor (MIA3) Antibody
20-abx307498	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody
abx216852-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody
abx235174-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody (HRP)
20-abx307499	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody (FITC)
20-abx307500	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody (Biotin)
20-abx307501	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1300505	ABM	3 x 1.0 ug	EUR 376

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4410205	ABM	3 x 1.0 ug	EUR 376

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1300506	ABM	1.0 ug DNA	EUR 167

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1300507	ABM	1.0 ug DNA	EUR 167

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1300508	ABM	1.0 ug DNA	EUR 167

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4410206	ABM	1.0 ug DNA	EUR 167

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4410207	ABM	1.0 ug DNA	EUR 167

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4410208	ABM	1.0 ug DNA	EUR 167