  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MIA3 antibody

23183-100ul 100ul
EUR 390.00

MIA3 antibody

70R-12614 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal MIA3 antibody

MIA3 Antibody

DF9622 200ul
EUR 304.00
Description: MIA3 Antibody detects endogenous levels of total MIA3.

MIA3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

anti- MIA3 antibody

FNab05174 100µg
EUR 505.25
  • Immunogen: melanoma inhibitory activity family, member 3
  • Uniprot ID: Q5JRA6
  • Gene ID: 375056
  • Research Area: Signal Transduction
Description: Antibody raised against MIA3

MIA3 Polyclonal Antibody

ES9796-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against MIA3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MIA3 Polyclonal Antibody

ES9796-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against MIA3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MIA3 Polyclonal Antibody

ABP59272-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of MIA3 from Human, Mouse. This MIA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190

MIA3 Polyclonal Antibody

ABP59272-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of MIA3 from Human, Mouse. This MIA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190

MIA3 Polyclonal Antibody

ABP59272-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of MIA3 from Human, Mouse. This MIA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA3 protein at amino acid sequence of 1110-1190

MIA3 Rabbit pAb

A15582-100ul 100 ul
EUR 308.00

MIA3 Rabbit pAb

A15582-200ul 200 ul
EUR 459.00

MIA3 Rabbit pAb

A15582-20ul 20 ul
EUR 183.00

MIA3 Rabbit pAb

A15582-50ul 50 ul
EUR 223.00

MIA3 Polyclonal Antibody

A65150 100 µg
EUR 570.55
Description: Ask the seller for details

MIA3 Polyclonal Antibody

29354-100ul 100ul
EUR 252.00

MIA3 Polyclonal Antibody

29354-50ul 50ul
EUR 187.00

MIA3 Blocking Peptide

DF9622-BP 1mg
EUR 195.00

MIA3 cloning plasmid

CSB-CL711448HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1386
  • Sequence: atgaaaaatcaaattaagcagatgatggatgtctctcggacacagactgcaatatcggtagttgaagaggatctaaagcttttacagcttaagctaagagcctccgtgtccactaaatgtaacctggaagaccaggtaaagaaattggaagatgaccgcaactcactacaagctg
  • Show more
Description: A cloning plasmid for the MIA3 gene.

Anti-MIA3 antibody

PAab05174 100 ug
EUR 355.00

Anti-MIA3 antibody

STJ117777 100 µl
EUR 277.00

Anti-MIA3 antibody

STJ190954 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to MIA3

Polyclonal TANGO / MIA3 Antibody

AMM08085G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TANGO / MIA3 . This antibody is tested and proven to work in the following applications:

MIA3 Polyclonal Conjugated Antibody

C29354 100ul
EUR 397.00

Mouse MIA3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF000783 96 Tests
EUR 689.00

Human MIA3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

MIA3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MIA3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MIA3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA3. Recognizes MIA3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MIA3 Polyclonal Antibody, HRP Conjugated

A65151 100 µg
EUR 570.55
Description: The best epigenetics products

MIA3 Polyclonal Antibody, FITC Conjugated

A65152 100 µg
EUR 570.55
Description: kits suitable for this type of research

MIA3 Polyclonal Antibody, Biotin Conjugated

A65153 100 µg
EUR 570.55
Description: fast delivery possible

MIA3 ORF Vector (Human) (pORF)

ORF006483 1.0 ug DNA
EUR 95.00

Mia3 ORF Vector (Mouse) (pORF)

ORF050194 1.0 ug DNA
EUR 1572.00

MIA3 ELISA Kit (Human) (OKCA01353)

OKCA01353 96 Wells
EUR 846.00
Description: Description of target: Plays a role in the transport of cargos that are too large to fit into COPII-coated vesicles and require specific mechanisms to be incorporated into membrane-bound carriers and exported from the endoplasmic reticulum. This protein is required for collagen VII (COL7A1) secretion by loading COL7A1 into transport carriers. It may participate in cargo loading of COL7A1 at endoplasmic reticulum exit sites by binding to COPII coat subunits Sec23/24 and guiding SH3-bound COL7A1 into a growing carrier. Does not play a role in global protein secretion and is apparently specific to COL7A1 cargo loading. However, it may participate in secretion of other proteins in cells that do not secrete COL7A1. It is also specifically required for the secretion of lipoproteins by participating in their export from the endoplasmic reticulum (PubMed:27138255).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.11 ng/mL

MIA3 sgRNA CRISPR Lentivector set (Human)

K1300501 3 x 1.0 ug
EUR 339.00

Mia3 sgRNA CRISPR Lentivector set (Mouse)

K4410201 3 x 1.0 ug
EUR 339.00

MIA3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1300502 1.0 ug DNA
EUR 154.00

MIA3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1300503 1.0 ug DNA
EUR 154.00

MIA3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1300504 1.0 ug DNA
EUR 154.00

Mia3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4410202 1.0 ug DNA
EUR 154.00

Mia3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4410203 1.0 ug DNA
EUR 154.00

Mia3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4410204 1.0 ug DNA
EUR 154.00

MIA3 Protein Vector (Human) (pPB-C-His)

PV025929 500 ng
EUR 329.00

MIA3 Protein Vector (Human) (pPB-N-His)

PV025930 500 ng
EUR 329.00

MIA3 Protein Vector (Human) (pPM-C-HA)

PV025931 500 ng
EUR 329.00

MIA3 Protein Vector (Human) (pPM-C-His)

PV025932 500 ng
EUR 329.00

MIA3 Protein Vector (Mouse) (pPB-C-His)

PV200774 500 ng
EUR 3192.00

MIA3 Protein Vector (Mouse) (pPB-N-His)

PV200775 500 ng
EUR 3192.00

MIA3 Protein Vector (Mouse) (pPM-C-HA)

PV200776 500 ng
EUR 3192.00

MIA3 Protein Vector (Mouse) (pPM-C-His)

PV200777 500 ng
EUR 3192.00

Mia3 3'UTR GFP Stable Cell Line

TU163187 1.0 ml Ask for price

MIA3 3'UTR Luciferase Stable Cell Line

TU013337 1.0 ml
EUR 2333.00

Mia3 3'UTR Luciferase Stable Cell Line

TU113187 1.0 ml Ask for price

MIA3 3'UTR GFP Stable Cell Line

TU063337 1.0 ml
EUR 2333.00

Mouse Melanoma inhibitory activity protein 3, Mia3 ELISA KIT

ELI-14026m 96 Tests
EUR 865.00

Bovine Melanoma inhibitory activity protein 3, MIA3 ELISA KIT

ELI-19513b 96 Tests
EUR 928.00

Human Melanoma inhibitory activity protein 3, MIA3 ELISA KIT

ELI-20371h 96 Tests
EUR 824.00

MIA Family Member 3, ER Export Factor (MIA3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody

abx216852-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody

abx235174-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

MIA Family Member 3, ER Export Factor (MIA3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1300505 3 x 1.0 ug
EUR 376.00

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4410205 3 x 1.0 ug
EUR 376.00

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1300506 1.0 ug DNA
EUR 167.00

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1300507 1.0 ug DNA
EUR 167.00

MIA3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1300508 1.0 ug DNA
EUR 167.00

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4410206 1.0 ug DNA
EUR 167.00

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4410207 1.0 ug DNA
EUR 167.00

Mia3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4410208 1.0 ug DNA
EUR 167.00