Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

DLR-RAB37-Hu-96T 96T
EUR 725
  • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RDR-RAB37-Hu-48Tests 48 Tests
EUR 589

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RDR-RAB37-Hu-96Tests 96 Tests
EUR 820

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RD-RAB37-Hu-48Tests 48 Tests
EUR 563

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RD-RAB37-Hu-96Tests 96 Tests
EUR 783

RAB37 antibody

70R-19705 50 ul
EUR 435
Description: Rabbit polyclonal RAB37 antibody

RAB37 Antibody

39738-100ul 100ul
EUR 390

RAB37 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB37. Recognizes RAB37 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB37 Antibody

DF4403 200ul
EUR 304
Description: RAB37 Antibody detects endogenous levels of total RAB37.

RAB37 antibody

70R-9347 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB37 antibody

RAB37 antibody

70R-9348 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB37 antibody

RAB37 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB37. Recognizes RAB37 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RAB37 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB37. Recognizes RAB37 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB37 Antibody

ABD4403 100 ug
EUR 438


YF-PA22962 50 ug
EUR 363
Description: Mouse polyclonal to RAB37


YF-PA22963 100 ug
EUR 403
Description: Rabbit polyclonal to RAB37

Rab37, Member Ras Oncogene Family (RAB37) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB37, Member RAS Oncogene Family (RAB37) Antibody

  • EUR 328.00
  • EUR 133.00
  • EUR 885.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RAB37, Member RAS Oncogene Family (RAB37) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

RAB37, Member RAS Oncogene Family (RAB37) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant RAB37, Member RAS Oncogene Family (RAB37)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96AX2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human RAB37, Member RAS Oncogene Family expressed in: E.coli

Human RAB37, Member RAS Oncogene Family (RAB37) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RAB37 Polyclonal Antibody

28314-100ul 100ul
EUR 252

RAB37 Polyclonal Antibody

28314-50ul 50ul
EUR 187

Anti-RAB37 Antibody

A10452 100ul
EUR 397
Description: Rabbit Polyclonal RAB37 Antibody. Validated in IHC, WB and tested in Human.

RAB37 Rabbit pAb

A13704-100ul 100 ul
EUR 308

RAB37 Rabbit pAb

A13704-200ul 200 ul
EUR 459

RAB37 Rabbit pAb

A13704-20ul 20 ul
EUR 183

RAB37 Rabbit pAb

A13704-50ul 50 ul
EUR 223

RAB37 Blocking Peptide

33R-2715 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB37 antibody, catalog no. 70R-9347

RAB37 Blocking Peptide

33R-8302 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB37 antibody, catalog no. 70R-9348

RAB37 Blocking Peptide

DF4403-BP 1mg
EUR 195

RAB37 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB37 cloning plasmid

CSB-CL842637HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atgacgggcacgccaggcgccgttgccacccgggatggcgaggcccccgagcgctccccgccctgcagtccgagctacgacctcacgggcaaggtgatgcttctgggagacacaggcgtcggcaaaacatgtttcctgatccaattcaaagacggggccttcctgtccggaacctt
  • Show more
Description: A cloning plasmid for the RAB37 gene.

RAB37 Polyclonal Antibody

A60490 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- RAB37 antibody

FNab07020 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: RAB37, member RAS oncogene family
  • Uniprot ID: Q96AX2
  • Gene ID: 326624
  • Research Area: Signal Transduction
Description: Antibody raised against RAB37

Anti-RAB37 antibody

PAab07020 100 ug
EUR 355

Anti-RAB37 antibody

STJ115659 100 µl
EUR 277

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB37, Member RAS Oncogene Family (RAB37) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human RAB37, Member RAS Oncogene Family(RAB37) ELISA Kit

QY-E04664 96T
EUR 361

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB37, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: Ras-related protein Rab-37
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB37 (RAB37, Member RAS Oncogene Family)

ELK6241 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB37, Member RAS Oncogene Family (RAB37). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB37, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37)

RAB37 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB37. Recognizes RAB37 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB37 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB37. Recognizes RAB37 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB37 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB37. Recognizes RAB37 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF002236 96 Tests
EUR 689

Human RAB37 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB37 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB37 Polyclonal Conjugated Antibody

C28314 100ul
EUR 397

pCMV-SPORT6-RAB37 Plasmid

PVT16138 2 ug
EUR 325

RAB37 Recombinant Protein (Human)

RP025489 100 ug Ask for price

RAB37 Recombinant Protein (Mouse)

RP166286 100 ug Ask for price

RAB37 Recombinant Protein (Mouse)

RP166289 100 ug Ask for price

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with APC.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with Biotin.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with Cy3.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with FITC.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with HRP.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with PE.

RAB37, Member RAS Oncogene Family (RAB37) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB37 (Ser19~Cys220)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse RAB37, Member RAS Oncogene Family (RAB37). This antibody is labeled with APC-Cy7.

Polyclonal RAB37 Antibody (aa170-219)

AMM07470G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB37 (aa170-219). This antibody is tested and proven to work in the following applications:

RAB37 Polyclonal Antibody, Biotin Conjugated

A60491 100 µg
EUR 570.55
Description: fast delivery possible

RAB37 Polyclonal Antibody, FITC Conjugated

A60492 100 µg
EUR 570.55
Description: reagents widely cited

RAB37 Polyclonal Antibody, HRP Conjugated

A60493 100 µg
EUR 570.55
Description: Ask the seller for details

RAB37 ORF Vector (Human) (pORF)

ORF008497 1.0 ug DNA
EUR 95

Rab37 ORF Vector (Mouse) (pORF)

ORF055430 1.0 ug DNA
EUR 506

Rab37 ORF Vector (Mouse) (pORF)

ORF055431 1.0 ug DNA
EUR 506

RAB37 ELISA Kit (Human) (OKCD02836)

OKCD02836 96 Wells
EUR 909
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.122 ng/mL

RAB37 ELISA Kit (Human) (OKEH07129)

OKEH07129 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

RAB37 ELISA Kit (Mouse) (OKEH05200)

OKEH05200 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.3 pg/mL

Rab37 sgRNA CRISPR Lentivector set (Mouse)

K3981101 3 x 1.0 ug
EUR 339

RAB37 sgRNA CRISPR Lentivector set (Human)

K1774001 3 x 1.0 ug
EUR 339

Ras-Related Protein Rab-37 (RAB37) Antibody

abx036499-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-37 (RAB37) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-37 (RAB37) Antibody

abx237020-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Ras-Related Protein Rab-37 (RAB37) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rab37 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3981102 1.0 ug DNA
EUR 154