UCHL1

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Hu-96T	DL Develop	96T	EUR 673.00
Should the Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Mu-48T	DL Develop	48T	EUR 527.00
Should the Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Mu-96T	DL Develop	96T	EUR 688.00
Should the Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Ra-48T	DL Develop	48T	EUR 549.00
Should the Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Ra-96T	DL Develop	96T	EUR 718.00
Should the Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Hu-48	DLdevelop	1 kit of 48 tests	EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Hu-96	DLdevelop	1 kit of 96 tests	EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Mu-192	DLdevelop	1 kit of 192 tests	EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Mu-48	DLdevelop	1 kit of 48 tests	EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Mu-96	DLdevelop	1 kit of 96 tests	EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Ra-192	DLdevelop	1 kit of 192 tests	EUR 1237.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Ra-48	DLdevelop	1 kit of 48 tests	EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Ra-96	DLdevelop	1 kit of 96 tests	EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533.00

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740.00

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775.00

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774.00

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583.00

Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811.00

UCHL1
PR22001	Neuromics	50 ug	EUR 565.00

UCHL1 Antibody
1-CSB-PA004876	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

UCHL1 Antibody
1-CSB-PA004381	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

UCHL1 Antibody
1-CSB-PA11637A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UCHL1 Antibody
1-CSB-PA025541GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UCHL1 antibody
20R-2874	Fitzgerald	100 ul	EUR 349.00
Description: Chicken polyclonal UCHL1 antibody

UCHL1 antibody
10R-10832	Fitzgerald	100 ug	EUR 381.00
Description: Mouse monoclonal UCHL1 antibody

UCHL1 antibody
10R-8391	Fitzgerald	100 ul	EUR 349.00
Description: Mouse monoclonal UCHL1 antibody

UCHL1 antibody
10R-8599	Fitzgerald	100 ul	EUR 393.00
Description: Mouse monoclonal UCHL1 antibody

UCHL1 Antibody
32615-100ul	SAB	100ul	EUR 252.00

UCHL1 protein
30R-3033	Fitzgerald	100 ug	EUR 354.00
Description: Purified recombinant UCHL1 protein

UCHL1 antibody
20R-UG001	Fitzgerald	250 ul	EUR 191.00
Description: Goat polyclonal UCHL1 antibody

UCHL1 Antibody
6130-50	Biovision		EUR 207.00

UCHL1 antibody
70R-21138	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal UCHL1 antibody

UCHL1 antibody
70R-9645	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal UCHL1 antibody

UCHL1 antibody
70R-9725	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal UCHL1 antibody

UCHL1 siRNA
20-abx905928	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCHL1 siRNA
20-abx938905	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCHL1 siRNA
20-abx938906	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCHL1 Antibody
CSB-PA869556-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

UCHL1 Antibody
CSB-PA869556-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

UCHL1 Antibody
DF6854	Affbiotech	200ul	EUR 304.00
Description: UCHL1 Antibody detects endogenous levels of total UCHL1.

UCHL1 Antibody
ABD6854	Lifescience Market	100 ug	EUR 438.00

UCHL1 antibody
70R-15422	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal UCHL1 antibody

UCHL1 protein
80R-4227	Fitzgerald	20 ug	EUR 349.00
Description: Recombinant Mouse UCHL1 protein with His tag

PGP9.5/UCHL1
MO22109	Neuromics	100 ul	EUR 435.00

PGP9.5/UCHL1
MO25040	Neuromics	500 ul	EUR 422.00

pOTB7-UCHL1
PVT18320	Lifescience Market	2 ug	EUR 231.00

PGP9.5/UCHL1
RA22118	Neuromics	100 ul	EUR 435.00

Polyclonal UCHL1 Antibody
APR13914G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human UCHL1 . This antibody is tested and proven to work in the following applications:

UCHL1 Conjugated Antibody
C32615	SAB	100ul	EUR 397.00

UCHL1 cloning plasmid
CSB-CL025541HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 672 Sequence: atgcagctcaagccgatggagatcaaccccgagatgctgaacaaagtgctgtcccggctgggggtcgccggccagtggcgcttcgtggacgtgctggggctggaagaggagtctctgggctcggtgccagcgcctgcctgcgcgctgctgctgctgtttcccctcacggcccagca Show more
Description: A cloning plasmid for the UCHL1 gene.

UCHL1/3 antibody
20R-2978	Fitzgerald	100 ul	EUR 393.00
Description: Rabbit polyclonal UCHL1/3 antibody

UCHL1 Blocking Peptide
33R-3793	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL1 antibody, catalog no. 70R-9645

UCHL1 Blocking Peptide
33R-2532	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL1 antibody, catalog no. 70R-9725

UCHL1 Monoclonal Antibody
27128-100ul	SAB	100ul	EUR 252.00

UCHL1 Monoclonal Antibody
27128-50ul	SAB	50ul	EUR 187.00

UCHL1 Polyclonal Antibody
A52002	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Human Recombinant UCHL1
6306-100	Biovision		EUR 425.00

UCHL1 / PGP9.5 Antibody
abx239218-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

UCHL1 Blocking Peptide
DF6854-BP	Affbiotech	1mg	EUR 195.00

UCHL1 Rabbit pAb
A2131-100ul	Abclonal	100 ul	EUR 308.00

UCHL1 Rabbit pAb
A2131-200ul	Abclonal	200 ul	EUR 459.00

UCHL1 Rabbit pAb
A2131-20ul	Abclonal	20 ul	EUR 183.00

UCHL1 Rabbit pAb
A2131-50ul	Abclonal	50 ul	EUR 223.00

UCHL1 antibody (HRP)
60R-2077	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal UCHL1 antibody (HRP)

UCHL1 antibody (FITC)
60R-2078	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal UCHL1 antibody (FITC)

UCHL1 antibody (biotin)
60R-2079	Fitzgerald	100 ug	EUR 349.00
Description: Rabbit polyclonal UCHL1 antibody (biotin)

UCHL1 Rabbit pAb
A0148-100ul	Abclonal	100 ul	EUR 308.00