UCHL1

Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Hu-96T 96T
EUR 673.00
  • Should the Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Mu-48T 48T
EUR 527.00
  • Should the Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Mu-96T 96T
EUR 688.00
  • Should the Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Ra-48T 48T
EUR 549.00
  • Should the Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Ra-96T 96T
EUR 718.00
  • Should the Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Mu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Ra-192 1 kit of 192 tests
EUR 1237.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Ra-48 1 kit of 48 tests
EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DL-UCHL1-Ra-96 1 kit of 96 tests
EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1)
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Hu-48Tests 48 Tests
EUR 521.00
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Hu-96Tests 96 Tests
EUR 723.00
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Mu-48Tests 48 Tests
EUR 533.00
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Mu-96Tests 96 Tests
EUR 740.00
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Ra-48Tests 48 Tests
EUR 557.00
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Ra-96Tests 96 Tests
EUR 775.00
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Hu-48Tests 48 Tests
EUR 544.00
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Hu-96Tests 96 Tests
EUR 756.00
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Mu-48Tests 48 Tests
EUR 557.00
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Mu-96Tests 96 Tests
EUR 774.00
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Ra-48Tests 48 Tests
EUR 583.00
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Ra-96Tests 96 Tests
EUR 811.00
UCHL1
PR22001 50 ug
EUR 565.00
UCHL1 Antibody
1-CSB-PA004876
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UCHL1 Antibody
1-CSB-PA004381
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
UCHL1 Antibody
1-CSB-PA11637A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
UCHL1 Antibody
1-CSB-PA025541GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
UCHL1 antibody
20R-2874 100 ul
EUR 349.00
Description: Chicken polyclonal UCHL1 antibody
UCHL1 antibody
10R-10832 100 ug
EUR 381.00
Description: Mouse monoclonal UCHL1 antibody
UCHL1 antibody
10R-8391 100 ul
EUR 349.00
Description: Mouse monoclonal UCHL1 antibody
UCHL1 antibody
10R-8599 100 ul
EUR 393.00
Description: Mouse monoclonal UCHL1 antibody
UCHL1 Antibody
32615-100ul 100ul
EUR 252.00
UCHL1 protein
30R-3033 100 ug
EUR 354.00
Description: Purified recombinant UCHL1 protein
UCHL1 antibody
20R-UG001 250 ul
EUR 191.00
Description: Goat polyclonal UCHL1 antibody
UCHL1 Antibody
6130-50
EUR 207.00
UCHL1 antibody
70R-21138 50 ul
EUR 435.00
Description: Rabbit polyclonal UCHL1 antibody
UCHL1 antibody
70R-9645 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal UCHL1 antibody
UCHL1 antibody
70R-9725 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal UCHL1 antibody
UCHL1 siRNA
20-abx905928
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCHL1 siRNA
20-abx938905
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCHL1 siRNA
20-abx938906
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCHL1 Antibody
CSB-PA869556-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UCHL1 Antibody
CSB-PA869556-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UCHL1 Antibody
DF6854 200ul
EUR 304.00
Description: UCHL1 Antibody detects endogenous levels of total UCHL1.
UCHL1 Antibody
ABD6854 100 ug
EUR 438.00
UCHL1 antibody
70R-15422 100 ug
EUR 327.00
Description: Rabbit polyclonal UCHL1 antibody
UCHL1 protein
80R-4227 20 ug
EUR 349.00
Description: Recombinant Mouse UCHL1 protein with His tag
PGP9.5/UCHL1
MO22109 100 ul
EUR 435.00
PGP9.5/UCHL1
MO25040 500 ul
EUR 422.00
pOTB7-UCHL1
PVT18320 2 ug
EUR 231.00
PGP9.5/UCHL1
RA22118 100 ul
EUR 435.00
Polyclonal UCHL1 Antibody
APR13914G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human UCHL1 . This antibody is tested and proven to work in the following applications:
UCHL1 Conjugated Antibody
C32615 100ul
EUR 397.00
UCHL1 cloning plasmid
CSB-CL025541HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atgcagctcaagccgatggagatcaaccccgagatgctgaacaaagtgctgtcccggctgggggtcgccggccagtggcgcttcgtggacgtgctggggctggaagaggagtctctgggctcggtgccagcgcctgcctgcgcgctgctgctgctgtttcccctcacggcccagca
  • Show more
Description: A cloning plasmid for the UCHL1 gene.
UCHL1/3 antibody
20R-2978 100 ul
EUR 393.00
Description: Rabbit polyclonal UCHL1/3 antibody
UCHL1 Blocking Peptide
33R-3793 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL1 antibody, catalog no. 70R-9645
UCHL1 Blocking Peptide
33R-2532 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL1 antibody, catalog no. 70R-9725
UCHL1 Monoclonal Antibody
27128-100ul 100ul
EUR 252.00
UCHL1 Monoclonal Antibody
27128-50ul 50ul
EUR 187.00
UCHL1 Polyclonal Antibody
A52002 100 µg
EUR 570.55
Description: reagents widely cited
Human Recombinant UCHL1
6306-100
EUR 425.00
UCHL1 / PGP9.5 Antibody
abx239218-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
UCHL1 Blocking Peptide
DF6854-BP 1mg
EUR 195.00
UCHL1 Rabbit pAb
A2131-100ul 100 ul
EUR 308.00
UCHL1 Rabbit pAb
A2131-200ul 200 ul
EUR 459.00
UCHL1 Rabbit pAb
A2131-20ul 20 ul
EUR 183.00
UCHL1 Rabbit pAb
A2131-50ul 50 ul
EUR 223.00
UCHL1 antibody (HRP)
60R-2077 100 ug
EUR 327.00
Description: Rabbit polyclonal UCHL1 antibody (HRP)
UCHL1 antibody (FITC)
60R-2078 100 ug
EUR 327.00
Description: Rabbit polyclonal UCHL1 antibody (FITC)
UCHL1 antibody (biotin)
60R-2079 100 ug
EUR 349.00
Description: Rabbit polyclonal UCHL1 antibody (biotin)
UCHL1 Rabbit pAb
A0148-100ul 100 ul
EUR 308.00