Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Hu-96T 96T
EUR 673
  • Should the Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Mu-48T 48T
EUR 527
  • Should the Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Mu-96T 96T
EUR 688
  • Should the Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Ra-48T 48T
EUR 549
  • Should the Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
DLR-UCHL1-Ra-96T 96T
EUR 718
  • Should the Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Hu-48Tests 48 Tests
EUR 544
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Hu-96Tests 96 Tests
EUR 756
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Mu-48Tests 48 Tests
EUR 557
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Mu-96Tests 96 Tests
EUR 774
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Ra-48Tests 48 Tests
EUR 583
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RDR-UCHL1-Ra-96Tests 96 Tests
EUR 811
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Hu-48Tests 48 Tests
EUR 521
Human Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Hu-96Tests 96 Tests
EUR 723
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Mu-48Tests 48 Tests
EUR 533
Mouse Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Mu-96Tests 96 Tests
EUR 740
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Ra-48Tests 48 Tests
EUR 557
Rat Ubiquitin Carboxyl Terminal Hydrolase L1 (UCHL1) ELISA Kit
RD-UCHL1-Ra-96Tests 96 Tests
EUR 775
PR22001 50 ug
EUR 565
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCHL1 protein
80R-4227 20 ug
EUR 349
Description: Recombinant Mouse UCHL1 protein with His tag
UCHL1 antibody
70R-21138 50 ul
EUR 435
Description: Rabbit polyclonal UCHL1 antibody
UCHL1 antibody
70R-9725 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UCHL1 antibody
UCHL1 antibody
70R-9645 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UCHL1 antibody
UCHL1 Antibody
ABD6854 100 ug
EUR 438
UCHL1 antibody
10R-10832 100 ug
EUR 381
Description: Mouse monoclonal UCHL1 antibody
UCHL1 antibody
10R-8391 100 ul
EUR 349
Description: Mouse monoclonal UCHL1 antibody
UCHL1 antibody
10R-8599 100 ul
EUR 393
Description: Mouse monoclonal UCHL1 antibody
UCHL1 protein
30R-3033 100 ug
EUR 354
Description: Purified recombinant UCHL1 protein
UCHL1 Antibody
32615-100ul 100ul
EUR 252
UCHL1 antibody
20R-UG001 250 ul
EUR 191
Description: Goat polyclonal UCHL1 antibody
UCHL1 antibody
20R-2874 100 ul
EUR 349
Description: Chicken polyclonal UCHL1 antibody
UCHL1 Antibody
EUR 207
UCHL1 antibody
70R-15422 100 ug
EUR 327
Description: Rabbit polyclonal UCHL1 antibody
UCHL1 Antibody
DF6854 200ul
EUR 304
Description: UCHL1 Antibody detects endogenous levels of total UCHL1.
UCHL1 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UCHL1 Antibody
CSB-PA869556-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UCHL1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
UCHL1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UCHL1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
UCHL1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UCHL1. Recognizes UCHL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
MO22109 100 ul
EUR 435
MO25040 500 ul
EUR 422
RA22118 100 ul
EUR 435
PVT18320 2 ug
EUR 231
Polyclonal UCHL1 Antibody
APR13914G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human UCHL1 . This antibody is tested and proven to work in the following applications:
UCHL1 Conjugated Antibody
C32615 100ul
EUR 397
UCHL1 cloning plasmid
CSB-CL025541HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atgcagctcaagccgatggagatcaaccccgagatgctgaacaaagtgctgtcccggctgggggtcgccggccagtggcgcttcgtggacgtgctggggctggaagaggagtctctgggctcggtgccagcgcctgcctgcgcgctgctgctgctgtttcccctcacggcccagca
  • Show more
Description: A cloning plasmid for the UCHL1 gene.
anti- UCHL1 antibody
FNab09217 100µg
EUR 548.75
  • Recommended dilution: WB: 1:5000-1:50000
  • IF: 1:20-1:200
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin carboxyl-terminal esterase L1(ubiquitin thiolesterase)
  • Uniprot ID: P09936
  • Gene ID: 7345
  • Research Area: Neuroscience, Cancer, Metabolism, Epigenetics
Description: Antibody raised against UCHL1
UCHL1 / PGP9.5 Antibody
abx239218-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
UCHL1 Rabbit pAb
A0148-100ul 100 ul
EUR 308
UCHL1 Rabbit pAb
A0148-200ul 200 ul
EUR 459
UCHL1 Rabbit pAb
A0148-20ul 20 ul
EUR 183
UCHL1 Rabbit pAb
A0148-50ul 50 ul
EUR 223
UCHL1 Polyclonal Antibody
A52002 100 µg
EUR 570.55
Description: reagents widely cited
UCHL1 Rabbit pAb
A2131-100ul 100 ul
EUR 308
UCHL1 Rabbit pAb
A2131-200ul 200 ul
EUR 459
UCHL1 Rabbit pAb
A2131-20ul 20 ul
EUR 183
UCHL1 Rabbit pAb
A2131-50ul 50 ul
EUR 223
UCHL1 Blocking Peptide
33R-3793 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL1 antibody, catalog no. 70R-9645
UCHL1 Blocking Peptide
33R-2532 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL1 antibody, catalog no. 70R-9725
UCHL1 Monoclonal Antibody
27128-100ul 100ul
EUR 252
UCHL1 Monoclonal Antibody
27128-50ul 50ul
EUR 187
UCHL1/3 antibody
20R-2978 100 ul
EUR 393
Description: Rabbit polyclonal UCHL1/3 antibody
UCHL1 antibody (HRP)
60R-2077 100 ug
EUR 327
Description: Rabbit polyclonal UCHL1 antibody (HRP)
UCHL1 antibody (FITC)
60R-2078 100 ug
EUR 327
Description: Rabbit polyclonal UCHL1 antibody (FITC)
UCHL1 antibody (biotin)
60R-2079 100 ug
EUR 349
Description: Rabbit polyclonal UCHL1 antibody (biotin)
Human Recombinant UCHL1
EUR 425
UCHL1 Blocking Peptide
DF6854-BP 1mg
EUR 195
LF-PA0197 100 ul
EUR 334
Description: Rabbit polyclonal to UCHL1/3
anti-UCHL1 (AF3F8)
LF-MA0319 100 ul
EUR 334
Description: Mouse monoclonal to UCHL1
Anti-UCHL1 antibody
STJ26028 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.
Anti-UCHL1 antibody
STJ114868 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.
Anti-PGP9.5/ UchL1 Antibody Clone UCHL1/775, Unconjugated-100ug
7345-MSM3-P1 100ug
EUR 428