FBXW2

FBXW2 Antibody

1-CSB-PA008524GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW2. Recognizes FBXW2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FBXW2 antibody

70R-2786 50 ug
EUR 467.00
Description: Rabbit polyclonal FBXW2 antibody raised against the middle region of FBXW2

FBXW2 siRNA

20-abx916662
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW2 siRNA

20-abx916663
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW2 Antibody

1-CSB-PA891730LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW2. Recognizes FBXW2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FBXW2 Antibody

DF13010 200ul
EUR 304.00
Description: FBXW2 Antibody detects endogenous levels of FBXW2.

FBXW2 antibody

70R-17268 50 ul
EUR 435.00
Description: Rabbit polyclonal FBXW2 antibody

FBXW2 cloning plasmid

CSB-CL891730HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atggagagaaaggactttgagacatggcttgataacatttctgttacatttctttctctgacggacttgcagaaaaatgaaactctggatcacctgattagtctgagtggggcagtccagctcaggcatctctccaataacctagagactctcctcaagcgggacttcctcaaac
  • Show more
Description: A cloning plasmid for the FBXW2 gene.

FBXW2 Blocking Peptide

33R-8600 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW2 antibody, catalog no. 70R-2786

FBXW2 Polyclonal Antibody

29532-100ul 100ul
EUR 252.00

FBXW2 Polyclonal Antibody

29532-50ul 50ul
EUR 187.00

FBXW2 Polyclonal Antibody

A68070 100 µg
EUR 570.55
Description: kits suitable for this type of research

FBXW2 Blocking Peptide

DF13010-BP 1mg
EUR 195.00

FBXW2 Rabbit pAb

A15996-100ul 100 ul
EUR 308.00

FBXW2 Rabbit pAb

A15996-200ul 200 ul
EUR 459.00

FBXW2 Rabbit pAb

A15996-20ul 20 ul
EUR 183.00

FBXW2 Rabbit pAb

A15996-50ul 50 ul
EUR 223.00

anti- FBXW2 antibody

FNab03054 100µg
EUR 505.25
  • Immunogen: F-box and WD repeat domain containing 2
  • Uniprot ID: Q9UKT8
  • Gene ID: 26190
  • Research Area: Metabolism
Description: Antibody raised against FBXW2

Anti-FBXW2 antibody

PAab03054 100 ug
EUR 355.00

Anti-FBXW2 antibody

STJ118455 100 µl
EUR 277.00

Anti-FBXW2 antibody

STJ70412 100 µg
EUR 359.00

FBXW2 Polyclonal Conjugated Antibody

C29532 100ul
EUR 397.00

Rat FBXW2 shRNA Plasmid

20-abx989700
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FBXW2 shRNA Plasmid

20-abx958752
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW2 Antibody, HRP conjugated

1-CSB-PA891730LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW2. Recognizes FBXW2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW2 Antibody, FITC conjugated

1-CSB-PA891730LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW2. Recognizes FBXW2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW2 Antibody, Biotin conjugated

1-CSB-PA891730LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW2. Recognizes FBXW2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW2 ELISA KIT|Human

EF009595 96 Tests
EUR 689.00

FBXW2 Recombinant Protein (Human)

RP011959 100 ug Ask for price

FBXW2 Recombinant Protein (Rat)

RP201074 100 ug Ask for price

FBXW2 Recombinant Protein (Mouse)

RP134117 100 ug Ask for price

FBXW2 Recombinant Protein (Mouse)

RP134120 100 ug Ask for price

FBXW2 Recombinant Protein (Mouse)

RP134123 100 ug Ask for price

FBXW2 Recombinant Protein (Mouse)

RP134126 100 ug Ask for price

FBXW2 Recombinant Protein (Mouse)

RP134129 100 ug Ask for price

Polyclonal Goat Anti-FBXW2 Antibody

APG00119G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FBXW2 . This antibody is tested and proven to work in the following applications:

FBXW2 Polyclonal Antibody, HRP Conjugated

A68071 100 µg
EUR 570.55
Description: fast delivery possible

FBXW2 Polyclonal Antibody, FITC Conjugated

A68072 100 µg
EUR 570.55
Description: reagents widely cited

FBXW2 Polyclonal Antibody, Biotin Conjugated

A68073 100 µg
EUR 570.55
Description: Ask the seller for details

FBXW2 ORF Vector (Human) (pORF)

ORF003987 1.0 ug DNA
EUR 95.00

Fbxw2 ORF Vector (Mouse) (pORF)

ORF044707 1.0 ug DNA
EUR 506.00

Fbxw2 ORF Vector (Mouse) (pORF)

ORF044708 1.0 ug DNA
EUR 506.00

Fbxw2 ORF Vector (Mouse) (pORF)

ORF044709 1.0 ug DNA
EUR 506.00

Fbxw2 ORF Vector (Mouse) (pORF)

ORF044710 1.0 ug DNA
EUR 506.00

Fbxw2 ORF Vector (Mouse) (pORF)

ORF044711 1.0 ug DNA
EUR 506.00

Fbxw2 ORF Vector (Rat) (pORF)

ORF067026 1.0 ug DNA
EUR 506.00

FBXW2 sgRNA CRISPR Lentivector set (Human)

K0767201 3 x 1.0 ug
EUR 339.00

Fbxw2 sgRNA CRISPR Lentivector set (Rat)

K6293501 3 x 1.0 ug
EUR 339.00

Fbxw2 sgRNA CRISPR Lentivector set (Mouse)

K3728601 3 x 1.0 ug
EUR 339.00

FBXW2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767202 1.0 ug DNA
EUR 154.00

FBXW2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767203 1.0 ug DNA
EUR 154.00

FBXW2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767204 1.0 ug DNA
EUR 154.00

Fbxw2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6293502 1.0 ug DNA
EUR 154.00

Fbxw2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6293503 1.0 ug DNA
EUR 154.00

Fbxw2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6293504 1.0 ug DNA
EUR 154.00

Fbxw2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3728602 1.0 ug DNA
EUR 154.00

Fbxw2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3728603 1.0 ug DNA
EUR 154.00

Fbxw2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3728604 1.0 ug DNA
EUR 154.00

FBXW2 Protein Vector (Rat) (pPB-C-His)

PV268102 500 ng
EUR 603.00

FBXW2 Protein Vector (Rat) (pPB-N-His)

PV268103 500 ng
EUR 603.00

FBXW2 Protein Vector (Rat) (pPM-C-HA)

PV268104 500 ng
EUR 603.00

FBXW2 Protein Vector (Rat) (pPM-C-His)

PV268105 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPB-C-His)

PV178826 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPB-N-His)

PV178827 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPM-C-HA)

PV178828 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPM-C-His)

PV178829 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPB-C-His)

PV178830 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPB-N-His)

PV178831 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPM-C-HA)

PV178832 500 ng
EUR 603.00

FBXW2 Protein Vector (Mouse) (pPM-C-His)

PV178833 500 ng
EUR 603.00