RAB6A antibody

22075-100ul 100ul
EUR 390.00

RAB6A Antibody

31154-100ul 100ul
EUR 252.00

RAB6A Antibody

31154-50ul 50ul
EUR 187.00

RAB6A antibody

70R-13381 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal RAB6A antibody

RAB6A antibody

70R-19721 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB6A antibody

RAB6A Antibody

34972-100ul 100ul
EUR 252.00

RAB6A Antibody

34972-50ul 50ul
EUR 187.00

RAB6A Antibody

32921-100ul 100ul
EUR 252.00

RAB6A Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RAB6A Antibody

CSB-PA918626-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RAB6A Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

RAB6A Antibody

DF4407 200ul
EUR 304.00
Description: RAB6A Antibody detects endogenous levels of total RAB6A.

RAB6A Antibody

DF7417 200ul
EUR 304.00
Description: RAB6A Antibody detects endogenous levels of total RAB6A.

RAB6A Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:25-1:100

RAB6A Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

RAB6A Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB6A Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB6A Antibody

ABD4407 100 ug
EUR 438.00

RAB6A Antibody

ABD7417 100 ug
EUR 438.00

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Rab6A, Member Ras Oncogene Family (RAB6A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

abx145583-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

abx237041-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

abx331888-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family (RAB6A) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB6A Rabbit pAb

A12089-100ul 100 ul
EUR 308.00

RAB6A Rabbit pAb

A12089-200ul 200 ul
EUR 459.00

RAB6A Rabbit pAb

A12089-20ul 20 ul
EUR 183.00

RAB6A Rabbit pAb

A12089-50ul 50 ul
EUR 223.00

RAB6A Blocking Peptide

DF4407-BP 1mg
EUR 195.00

RAB6A Blocking Peptide

DF7417-BP 1mg
EUR 195.00

Anti-RAB6A Antibody

A02911-1 100ug/vial
EUR 334.00

RAB6A Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Polyclonal RAB6A Antibody

AMM07485G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB6A . This antibody is tested and proven to work in the following applications:

RAB6A Conjugated Antibody

C32921 100ul
EUR 397.00

RAB6A Conjugated Antibody

C31154 100ul
EUR 397.00

RAB6A cloning plasmid

CSB-CL019216HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atgtccacgggcggagacttcgggaatccgctgaggaaattcaagctggtgttcctgggggagcaaagcgttggaaagacatctttgatcaccagattcatgtatgacagttttgacaacacctatcaggcaacaattggcattgactttttatcaaaaactatgtacttggagga
  • Show more
Description: A cloning plasmid for the RAB6A gene.

RAB6A Polyclonal Antibody

A57161 100 µg
EUR 570.55
Description: fast delivery possible

RAB6A Rabbit pAb

A5613-100ul 100 ul
EUR 308.00

RAB6A Rabbit pAb

A5613-200ul 200 ul
EUR 459.00

RAB6A Rabbit pAb

A5613-20ul 20 ul
EUR 183.00

RAB6A Rabbit pAb

A5613-50ul 50 ul
EUR 223.00

anti- RAB6A antibody

FNab07041 100µg
EUR 548.75
  • Immunogen: RAB6A, member RAS oncogene family
  • Uniprot ID: P20340
  • Gene ID: 5870
  • Research Area: Signal Transduction
Description: Antibody raised against RAB6A

Anti-RAB6A antibody

PAab07041 100 ug
EUR 386.00

pSV40- Rab6a- m

PVT11665 2 ug
EUR 273.00

Anti-RAB6A antibody

STJ27580 100 µl
EUR 277.00
Description: This gene encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. This protein is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. This protein is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-RAB6A antibody

STJ113986 100 µl
EUR 277.00
Description: This gene encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. This protein is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. This protein is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-RAB6A antibody

STJ13100308 100 µl
EUR 427.00

Anti-Rab6A (3G3)

YF-MA10764 100 ug
EUR 363.00
Description: Mouse monoclonal to Rab6A

RAB6A protein (His tag)

80R-1592 50 ug
EUR 305.00
Description: Purified recombinant Human RAB6A protein


EF002256 96 Tests
EUR 689.00

Mouse RAB6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB6A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB6A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB6A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6A. Recognizes RAB6A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RAB6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB6A Recombinant Protein (Human)

RP025537 100 ug Ask for price

RAB6A Recombinant Protein (Mouse)

RP166361 100 ug Ask for price

RAB6A Recombinant Protein (Mouse)

RP166364 100 ug Ask for price

RAB6A Recombinant Protein (Rat)

RP223379 100 ug Ask for price

RAB6A Polyclonal Antibody, HRP Conjugated

A57162 100 µg
EUR 570.55
Description: reagents widely cited

RAB6A Polyclonal Antibody, FITC Conjugated

A57163 100 µg
EUR 570.55
Description: Ask the seller for details

RAB6A Polyclonal Antibody, Biotin Conjugated

A57164 100 µg
EUR 570.55
Description: The best epigenetics products

Rab6a ORF Vector (Rat) (pORF)

ORF074461 1.0 ug DNA
EUR 506.00

RAB6A ORF Vector (Human) (pORF)

ORF008513 1.0 ug DNA
EUR 95.00

Rab6a ORF Vector (Mouse) (pORF)

ORF055455 1.0 ug DNA
EUR 506.00

Rab6a ORF Vector (Mouse) (pORF)

ORF055456 1.0 ug DNA
EUR 506.00

Polyclonal RAB6A / RAB6 Antibody (aa1-208)

AMM07484G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB6A / RAB6 (aa1-208). This antibody is tested and proven to work in the following applications:

RAB6A, Member RAS Oncogene Family Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Rab6a sgRNA CRISPR Lentivector set (Rat)

K7097501 3 x 1.0 ug
EUR 339.00

RAB6A sgRNA CRISPR Lentivector set (Human)

K1769701 3 x 1.0 ug
EUR 339.00

Recombinant Human RAB6A, Member RAS Oncogene Family

7-05998 2µg Ask for price