PMM2 antibody

70R-13583 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PMM2 antibody

PMM2 antibody

10R-11449 50 ul
EUR 241
Description: Mouse Monoclonal PMM2 antibody

PMM2 Antibody

39827-100ul 100ul
EUR 390

PMM2 Antibody

DF12455 200ul
EUR 304
Description: PMM2 antibody detects endogenous levels of PMM2.

PMM2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PMM2. Recognizes PMM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

PMM2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PMM2. Recognizes PMM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PMM2 antibody

70R-35379 100 ug
EUR 349
Description: Purified Rabbit polyclonal PMM2 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13843 50 ul
EUR 363
Description: Mouse polyclonal to PMM2


YF-PA13844 100 ul
EUR 403
Description: Rabbit polyclonal to PMM2


YF-PA24406 50 ul
EUR 334
Description: Mouse polyclonal to PMM2

PMM2 Polyclonal Antibody

30513-100ul 100ul
EUR 252

PMM2 Polyclonal Antibody

30513-50ul 50ul
EUR 187

Human PMM2 Antibody

33120-05111 150 ug
EUR 261

PMM2 Blocking Peptide

DF12455-BP 1mg
EUR 195

PMM2 cloning plasmid

CSB-CL018238HU-10ug 10ug
EUR 317
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atggcagcgcctggcccagcgctctgcctcttcgacgtggatgggaccctcaccgccccgcggcagaaaattaccaaagaaatggatgacttcctacaaaaattgaggcagaagatcaaaatcggagtggtaggcggatcggactttgagaaagtgcaggagcaactgggaaatga
  • Show more
Description: A cloning plasmid for the PMM2 gene.

PMM2 Rabbit pAb

A4026-100ul 100 ul
EUR 308

PMM2 Rabbit pAb

A4026-200ul 200 ul
EUR 459

PMM2 Rabbit pAb

A4026-20ul 20 ul
EUR 183

PMM2 Rabbit pAb

A4026-50ul 50 ul
EUR 223

anti- PMM2 antibody

FNab06574 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: phosphomannomutase 2
  • Uniprot ID: O15305
  • Gene ID: 5373
  • Research Area: Metabolism
Description: Antibody raised against PMM2

Anti-PMM2 antibody

PAab06574 100 ug
EUR 355

Anti-PMM2 antibody

STJ25035 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate, which is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. Mutations in this gene have been shown to cause defects in glycoprotein biosynthesis, which manifests as carbohydrate-deficient glycoprotein syndrome type I.

Anti-PMM2 (2E9)

YF-MA14784 100 ug
EUR 363
Description: Mouse monoclonal to PMM2

Anti-PMM2 (2A5)

YF-MA14785 100 ug
EUR 363
Description: Mouse monoclonal to PMM2

Human Phosphomannomutase 2 (PMM2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phosphomannomutase 2(PMM2) expressed in E.coli

PMM2 protein (His tag)

80R-1489 100 ug
EUR 305
Description: Purified recombinant Human PMM2 protein

Phosphomannomutase 2 (PMM2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx036284-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx030709-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx030709-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.


EF001886 96 Tests
EUR 689

Mouse PMM2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PMM2 Polyclonal Conjugated Antibody

C30513 100ul
EUR 397

Phosphomannomutase 2 (PMM2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx236574-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human PMM2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PMM2 Recombinant Protein (Human)

RP023899 100 ug Ask for price

PMM2 Recombinant Protein (Mouse)

RP163076 100 ug Ask for price

PMM2 Recombinant Protein (Rat)

RP221126 100 ug Ask for price

Human PMM2 Antibody (Biotin Conjugate)

33120-05121 150 ug
EUR 369

Polyclonal PMM2 Antibody (C-term)

AMR09398G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PMM2 (C-term). This antibody is tested and proven to work in the following applications:

Pmm2 ORF Vector (Rat) (pORF)

ORF073710 1.0 ug DNA
EUR 506

PMM2 ORF Vector (Human) (pORF)

ORF007967 1.0 ug DNA
EUR 95

Pmm2 ORF Vector (Mouse) (pORF)

ORF054360 1.0 ug DNA
EUR 506

Human PMM2 AssayLite Antibody (FITC Conjugate)

33120-05141 150 ug
EUR 428

Human PMM2 AssayLite Antibody (RPE Conjugate)

33120-05151 150 ug
EUR 428

Human PMM2 AssayLite Antibody (APC Conjugate)

33120-05161 150 ug
EUR 428

Human PMM2 AssayLite Antibody (PerCP Conjugate)

33120-05171 150 ug
EUR 471

Polyclonal PMM2 antibody - N-terminal region

AMR09401G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PMM2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Bovine Phosphomannomutase 2, PMM2 ELISA KIT

ELI-16337b 96 Tests
EUR 928

Human Phosphomannomutase 2, PMM2 ELISA KIT

ELI-19693h 96 Tests
EUR 824

Mouse Phosphomannomutase 2, Pmm2 ELISA KIT

ELI-45541m 96 Tests
EUR 865