Impact of normal supply of care on receiving smoking cessation recommendation: Korean Nationwide Well being Panel knowledge evaluation

Background: Regardless of numerous anti-smoking insurance policies, the smoking charge in adults continues to be excessive in Korea. Docs’ recommendation is thought to extend the smoking cessation success charge. Nevertheless, few research have reported the impact of getting a normal supply of care (USC) on receiving smoking cessation recommendation.

 

Goal: To find out the impact of USC on receiving smoking cessation recommendation.

 

Strategies: We carried out a number of panel logistic regression analyses to determine the impact of getting a USC on the speed of receiving a health care provider’s smoking cessation recommendation utilizing 2009, 2012 and 2013 datasets from the Korea Well being Panel database. Solely individuals who responded to questions concerning a USC and smoking cessation recommendation have been analysed. Finally, 5243 observations have been included within the ultimate evaluation.

 

Outcomes: A better proportion of individuals with a USC acquired smoking cessation recommendation from medical doctors (58.4% in 2009, 64.0% in 2012 and 59.6% in 2013) than these not having a USC (28.6% in 2009, 37.5% in 2012 and 34.8% in 2013). The percentages ratios (ORs) of receiving smoking cessation recommendation in individuals with a USC have been greater than these of individuals with out a USC after performing a number of panel logistic regression evaluation with random results (OR: 2.24; 95% confidence interval: 1.90-2.63).

 

Conclusions: Having a USC elevated the chances of receiving a health care provider’s smoking cessation recommendation in Koreans. The outcomes of this examine counsel {that a} well being care coverage that encourages having a USC is beneficial in receiving extra smoking cessation recommendation in a Korean inhabitants.

 

gemini-genomics
gemini-genomics

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218.00

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485.00

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218.00

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485.00

HAV

DAG178 1 ml
EUR 629.00

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886.00

HAV HAV P2C recombinant antigen

00165-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

HAV HAV P2C recombinant antigen

00165-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

IVD antibody

22140-100ul 100ul
EUR 390.00

IVD antibody

70R-18039 50 ul
EUR 435.00
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691.00
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304.00
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-IVD

YF-PA12811 50 ug
EUR 363.00
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403.00
Description: Rabbit polyclonal to IVD

HAV VP1

DAG1443 100 µg
EUR 645.00

HAV VP3

DAG1450 100 µg
EUR 645.00

HAV Protein

abx069838-1ml 1 ml
EUR 314.00
  • Shipped within 5-10 working days.

HAV Protein

abx069839-1ml 1 ml
EUR 982.00
  • Shipped within 5-10 working days.

HAV Antigen

E61H00101 1mg
EUR 611.00

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA

BBV15-N-100 100 ug
EUR 286.00

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252.00

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187.00

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308.00

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459.00

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183.00

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223.00

Human IVD Antibody

33170-05111 150 ug
EUR 261.00

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195.00

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585.00
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody

PAab04426 100 ug
EUR 355.00

Anti-IVD antibody

STJ117476 100 µl
EUR 277.00
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510.00

IVD, Human Recombinant

P1577-20 20 µg
EUR 156.00

Saponin Vaccine Adjuvant

VAdv-Ly0009 1 g
EUR 1095.00
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

HAV VP3 antibody

10R-10488 100 ug
EUR 435.00
Description: Mouse monoclonal HAV VP3 antibody

HAV VP3 antibody

10R-10489 100 ug
EUR 435.00
Description: Mouse monoclonal HAV VP3 antibody

HAV VP1 antibody

10R-10520 100 ug
EUR 435.00
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody

10R-10521 100 ug
EUR 435.00
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody

10R-10522 100 ug
EUR 435.00
Description: Mouse monoclonal HAV VP1 antibody

HAV P2C-P3A

DAG1448 100 µg
EUR 645.00

HAV VP2-VP4

DAG1451 100 µg
EUR 645.00

HAV VP3 Antibody

abx018272-100ug 100 ug
EUR 384.00
  • Shipped within 5-10 working days.

HAV VP3 Antibody

abx018273-100ug 100 ug
EUR 384.00
  • Shipped within 5-10 working days.

HAV VP1 Antibody

abx018304-100ug 100 ug
EUR 384.00
  • Shipped within 5-10 working days.

HAV VP1 Antibody

abx018305-100ug 100 ug
EUR 384.00
  • Shipped within 5-10 working days.

HAV VP1 Antibody

abx018306-100ug 100 ug
EUR 384.00
  • Shipped within 5-10 working days.

HAV P3C Protein

abx060523-1mg 1 mg
EUR 1511.00
  • Shipped within 5-10 working days.

HAV VP1 Protein

abx060524-1mg 1 mg
EUR 1525.00
  • Shipped within 5-10 working days.

HAV VP3 Protein

abx060526-1mg 1 mg
EUR 1525.00
  • Shipped within 5-10 working days.

HAV monoclonal antibody

VAnt-Lsx001-1mg 1 mg
EUR 2577.00
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV monoclonal antibody

VAnt-Lsx001-5mg 5mg
EUR 4970.00
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV antibody (HRP)

VAnt-Lsx014-1mg 1 mg
EUR 3268.00
Description: HRP is conjugated to HAV antibody to detect the target molecule.

HAV antibody (HRP)

VAnt-Lsx014-5mg 5mg
EUR 6163.00
Description: HRP is conjugated to HAV antibody to detect the target molecule.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant

AV-7010-50 50 ug
EUR 895.00

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103.00

IVD protein (His tag)

80R-1262 100 ug
EUR 268.00
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824.00

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928.00

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689.00

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865.00

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397.00

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for Age-BSA

2221-BSA
EUR 175.00

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224.00
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Calcium phosphate vaccine adjuvant

AV-1020-100 100 ml
EUR 219.00

Peanut Oil vaccine adjuvant

AV-5010-50 50 ml
EUR 225.00

Mineral Oil vaccine adjuvant

AV-5020-50 50 ml
EUR 225.00

Mannide monooleate vaccine adjuvant

AV-5030-5 5 g
EUR 164.00

HS15 Kolliphore vaccine adjuvant

AV-6010-100 100 g
EUR 286.00

Pam2CSK4 vaccine adjuvant, unlabeled

AV-9020-1 1 mg
EUR 408.00

Pam3CSK4 vaccine adjuvant, unlabeled

AV-9025-1 1 mg
EUR 286.00

Hepatitis A Virus (HAV) antigens (FRhk4, inactivated) for ELISA

HAV15-N-100 100 ug
EUR 347.00

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA

HPV618L13-S 1 ml
EUR 469.00

HAV P3C recombinant antigen

00162-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV P3C recombinant antigen a.a. 1643-1743.

HAV P3C recombinant antigen

00162-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV P3C recombinant antigen a.a. 1643-1743.

HAV VP3 recombinant antigen

00163-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV VP3 recombinant antigen a.a. 304-415.

HAV VP3 recombinant antigen

00163-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV VP3 recombinant antigen a.a. 304-415.

HAV IgM ELISA Kit

DEIA1012 96T
EUR 533.00
Description: HAV-IgM ELISA is an enzyme-linked immunosorbent assay for qualitative determination of hepatitis A virus IgM-class antibodies in human serum or plasma samples. The assay is intended to be used in clinical laboratories for diagnosis and management of patients related to infection with hepatitis A virus.

HAV P2C-P3A Protein

abx060522-1mg 1 mg
EUR 1511.00
  • Shipped within 5-10 working days.

HAV VP1-P2A Protein

abx060525-1mg 1 mg
EUR 1525.00
  • Shipped within 5-10 working days.

HAV Grade II Concentrate

VAng-0506Lsx-inquire inquire Ask for price
Description: HAV Grade II Concentrate from FRhK-4 Cells.

Inactivated HAV Antigen (Monkey)

VAng-Lsx0156-inquire inquire Ask for price
Description: HAV, native protein from monkey. Inactivated native Hepatitis A Virus Antigen preparation is inactivated by incubating with formaldehyde for 96 hours.

Inactivated HAV Antigen (Human)

VAng-Lsx0157-1mL 1 mL
EUR 226.00
Description: HAV-Antigen is prepared of the supernatant of infected Wannenstapel and dialysed against phosphat buffered saline.

Recombinant HAV VP3 Protein

VAng-Lsx0167-100g 100 µg
EUR 465.00
Description: HAV VP3, recombinant protein from E. coli.

Recombinant HAV VP3 Protein

VAng-Lsx0167-1mg 1 mg
EUR 2817.00
Description: HAV VP3, recombinant protein from E. coli.

Recombinant HAV VP3 Protein

VAng-Lsx0167-500g 500 µg
EUR 1711.00
Description: HAV VP3, recombinant protein from E. coli.

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Rabbit Anti-West Nile Virus vaccine (WNV, Recombitek/DNA vaccine) antiserum

WNV13-S 100 ul
EUR 457.00

ELISA kit for Human Hepatitis A Virus IgG (HAV IgG)

KTE62858-48T 48T
EUR 354.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis A Virus IgG (HAV IgG)

KTE62858-5platesof96wells 5 plates of 96 wells
EUR 2252.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis A Virus IgG (HAV IgG)

KTE62858-96T 96T
EUR 572.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Hepatitis A Virus IgG (HAV IgG)

KTE71598-48T 48T
EUR 354.00
Description: Quantitative sandwich ELISA for measuring Mouse Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Hepatitis A Virus IgG (HAV IgG)

KTE71598-5platesof96wells 5 plates of 96 wells
EUR 2252.00
Description: Quantitative sandwich ELISA for measuring Mouse Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Hepatitis A Virus IgG (HAV IgG)

KTE71598-96T 96T
EUR 572.00
Description: Quantitative sandwich ELISA for measuring Mouse Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85.00
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85.00
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133.00

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85.00
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98.00

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286.00

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164.00

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369.00

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506.00

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95.00

Ivd ORF Vector (Mouse) (pORF)

ORF048200 1.0 ug DNA
EUR 506.00

Peptidoglycan (S. aureus); vaccine adjuvant

AV-7045-25 25 mg
EUR 1017.00

Peptidoglycan (S. aureus); vaccine adjuvant

AV-7045-5 5 mg
EUR 286.00

RWJ 21757 Synthetic vaccine adjuvant

AV-9010-1 1 mg
EUR 164.00

RWJ 21757 Synthetic vaccine adjuvant

AV-9010-5 5 mg
EUR 286.00

Pam2CSK4 vaccine adjuvant; Biotin conjugate

AV-9020-B 1 mg
EUR 408.00

Pam2CSK4 vaccine adjuvant; Biotin conjugate

AV-9020-B-100 100 ug
EUR 164.00

Pam3CSK4 vaccine adjuvant; Biotin labelled

AV-9025-B 100 ug
EUR 347.00

Pam3CSK4 vaccine adjuvant; FITC labelled

AV-9025-F 100 ug
EUR 347.00

Pertussis Toxin B.Pertussis, vaccine grade

AV-9130-50 50 ug
EUR 529.00

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA

20021-1 100 ug
EUR 225.00

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-1 100 ug
EUR 225.00

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-2 100 ug
EUR 225.00

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20025-1 100 ug
EUR 225.00

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20026-1 100 ug
EUR 225.00

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20027-1 100 ug
EUR 225.00

Rabbit Anti-Gardasil vaccine (merck) antiserum (Human Papilloma Virus 16+18 (HPV16/18) late proteins L1 (HPV16+18L1) control for ELISA

HPV16181-S 500 ul
EUR 469.00

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)

MEK1010 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)

MEK1011 1 kit
EUR 1084.00

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)

MEK1012 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)

MEK1013 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)

MEK1015 1 kit
EUR 879.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)

MEK1016 1 kit
EUR 879.00

HAV VP1-P2A recombinant antigen

00159-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 722-830.

HAV VP1-P2A recombinant antigen

00159-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 722-830.

HAV VP4-VP2 recombinant antigen

00160-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV VP4-VP2 recombinant antigen a.a. 55-164.

HAV VP4-VP2 recombinant antigen

00160-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV VP4-VP2 recombinant antigen a.a. 55-164.

HAV P2C-P3A recombinant antigen

00161-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1492-1606.

HAV P2C-P3A recombinant antigen

00161-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1492-1606.

HAV VP1-P2A recombinant antigen

00164-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 669-782.

HAV VP1-P2A recombinant antigen

00164-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 669-782.

HAV P2C-P3A recombinant antigen

00166-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1392-1521.

HAV P2C-P3A recombinant antigen

00166-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1392-1521.

Goat Anti-HAV Polyclonal Antibody

DPAB0224 1 ml
EUR 833.00

HAV P2C (aa 1121 - 1234)

DAG2384 100 µg
EUR 724.00

HAV P3C (aa 1643 - 1743)

DAG2388 100 µg
EUR 724.00

HAV VP1 (aa 502 - 605)

DAG3317 100 µg
EUR 810.00

Anti-HAV IgG ELISA Kit

DEIA007 96T
EUR 485.00
Description: Human HAV-IgG ELISA Kit is an enzyme linked-immunosorbent assay (ELISA) for qualitative detection of IgG-class antibodies to hepatitis A virus in human serum or plasma. It is intended for use in clinical laboratories for diagnosis and monitoring of patients related to infection with hepatitis A virus.

Anti-HAV IgM ELISA Kit

DEIA008 96T
EUR 723.00
Description: HAV-IgM ELISA is an enzyme-linked immunosorbent assay for qualitative determination of hepatitis A virus IgM-class antibodies in human serum or plasma samples. The assay is intended to be used in clinical laboratories for diagnosis and management of patients related to infection with hepatitis A virus.

HAV antibody IgM ELISA test

75 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HAV antibody IgM

Hepatitis A Virus (HAV) Antibody

abx024089-1mg 1 mg
EUR 1177.00
  • Shipped within 5-10 working days.

Hepatitis A Virus (HAV) Antibody

abx024090-1mg 1 mg
EUR 1177.00
  • Shipped within 5-10 working days.

Hepatitis A Virus (HAV) Antibody

abx024091-1mg 1 mg
EUR 1177.00
  • Shipped within 5-10 working days.

Human Anti-HAV ELISA Kit

EHA0822 96Tests
EUR 521.00

Human HAV IgA ELISA Kit

EHH0031 96Tests
EUR 521.00

Human HAV IgG ELISA Kit

EHH0032 96Tests
EUR 521.00

Human HAV IgM ELISA Kit

EHH0033 96Tests
EUR 521.00

Human HAV IgD ELISA Kit

EHH0034 96Tests
EUR 521.00

Goat Anti-HAV ELISA Kit

EGTA0822 96Tests
EUR 521.00

Goat HAV IgA ELISA Kit

EGTH0031 96Tests
EUR 521.00

Goat HAV IgG ELISA Kit

EGTH0032 96Tests
EUR 521.00

Goat HAV IgM ELISA Kit

EGTH0033 96Tests
EUR 521.00

Goat HAV IgD ELISA Kit

EGTH0034 96Tests
EUR 521.00

Bovine Anti-HAV ELISA Kit

EBA0822 96Tests
EUR 521.00

Bovine HAV IgA ELISA Kit

EBH0031 96Tests
EUR 521.00

Bovine HAV IgG ELISA Kit

EBH0032 96Tests
EUR 521.00

Bovine HAV IgM ELISA Kit

EBH0033 96Tests
EUR 521.00

Bovine HAV IgD ELISA Kit

EBH0034 96Tests
EUR 521.00

Canine Anti-HAV ELISA Kit

ECA0822 96Tests
EUR 521.00

Canine HAV IgA ELISA Kit

ECH0031 96Tests
EUR 521.00

 

Consciousness of and Attitudes Towards Consumer Involvement in Analysis on Growing old and Well being: Protocol for a Quantitative Giant-Scale Panel Examine

Background: Consumer involvement is a requirement of most analysis funders. There’s a rising physique of literature exploring the advantages and challenges of consumer involvement in analysis, however such research are scarce within the subject of growing old and well being.

 

Furthermore, the vast majority of such analysis is qualitative, which limits the generalizability of outcomes. The UserAge panel examine can be instrumental in increasing data that may profit the standard and impression of consumer involvement in future analysis.

 

Goal: The goal of this examine is to find out the attention and understanding of and attitudes towards consumer involvement in analysis amongst totally different classes of information customers and researchers over time.

 

Strategies: A panel examine can be applied with three totally different classes of information customers (individuals aged 60 years and older, casual carers, and professionals in well being care and structure) and researchers in growing old and well being.

  • An expert survey firm will acquire knowledge from all samples in parallel. Potential members can be requested to finish the survey by way of phone or on-line, or members can request a paper survey to be despatched to them within the submit. A draft set of questions on attitudes and behavioral patterns associated to analysis utilization and consumer involvement in analysis was compiled based mostly on present literature and enter from the analysis crew.
  • Utilizing a participatory strategy, we engaged a consumer discussion board, the place Eight older individuals and three researchers collectively refined the survey for time/size to finish, terminology, readability, and context. Information collected by way of the web or phone can be robotically processed, and knowledge collected on paper kinds can be entered in machine-readable kinds.
  • The survey firm will retailer all knowledge and ship the quality-controlled database to the college for additional storage. Analyses of frequencies and measures of central tendency can be used for descriptive functions. To check teams, state-of-the artwork statistical analyses can be used.

 

Outcomes: Information assortment for the primary examine wave began in September 2019 and can be accomplished in spring 2020. Information can be prepared for evaluation following cleansing and high quality management, which began throughout summer season 2020 and can be accomplished autumn 2020. We anticipate the info assortment for the second examine wave to start out in September 2021.

 

Conclusions: That is the primary quantitative large-scale panel examine specializing in tendencies in attitudes towards, consciousness of, and data about consumer involvement in analysis on growing old and well being in Sweden. The outcomes will generate new and vital data to advance the understanding of consumer wants and preferences in addition to the relevance of consumer involvement in analysis on growing old and well being.

 

HBV LONGITUDINAL PANEL (12 X 1 mL)

6548 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6501 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (15 X 1 mL)

6512 15 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6516 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6518 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6528 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6529 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6538 12 X 1 mL
EUR 1261.60
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Positive control tissue section for each antibody; Based on availability INQUIRE

Control-Slides Set of 5
EUR 176.00

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218.00

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485.00

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218.00

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485.00

HBV Seroconversion Panel Donor# 64090 (5 X 1 mL)

HBV10231 5 X 1 mL
EUR 582.48
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64090 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64017 (6 X 1 mL)

HBV10232 6 X 1 mL
EUR 582.48
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64017 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65449 (9 X 1 mL)

HBV11000 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65524 (8 X 1 mL)

HBV11001 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65524 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65556 (6 X 1 mL)

HBV11002 6 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65556 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65584 (8 X 1 mL)

HBV11003 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65584 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65732 (8 X 1 mL)

HBV11004 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65732 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65777 (14 X 1 mL)

HBV11005 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65777 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66201 (17 X 1 mL)

HBV11006 17 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66201 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66537 (14 X 1 mL)

HBV11007 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66537 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67303 (18 X 1 mL)

HBV11008 18 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67303 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67449 (23 X 1 mL)

HBV11009 23 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67457 (18 X 1 mL)

HBV11010 18 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67457 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67694 (14 X 1 mL)

HBV11011 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67694 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67773 (6 X 1 mL)

HBV11012 6 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67773 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67962 (35 X 1 mL)

HBV11013 35 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67962 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68029 (12 X 1 mL)

HBV11014 12 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68029 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68105 (14 X 1 mL)

HBV11015 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68105 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68541 (10 X 1 mL)

HBV11016 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68541 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68739 (14 X 1 mL)

HBV11017 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68739 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70793 (14 X 1 mL)

HBV11024 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 70793 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70970 (16 X 1 mL)

HBV11026 16 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 70970 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71415 (13 X 1 mL)

HBV11027 13 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71415 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71840 (10 X 1 mL)

HBV11028 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71840 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 69751 (13 X 1 mL)

HBV11029 13 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 69751 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70292 (15 X 1 mL)

HBV11031 15 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 70292 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72439 (13 X 1 mL)

HBV11052 13 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 72439 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72474 (11 X 1 mL)

HBV11056 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 72474 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71612 (8 X 1 mL)

HBV11058 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71612 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72324 (9 X 1 mL)

HBV11059 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 72324 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71922 (11 X 1 mL)

HBV11062 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71922 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71782 (9 X 1 mL)

HBV11064 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71782 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 73299 (15 X 1 mL)

HBV11069 15 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 73299 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61248 (5 X 1 mL)

HBV6271 5 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61248 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61291 (25 X 1 mL)

HBV6272 25 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61291 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61042 (6 X 1 mL)

HBV6273 6 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61042 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61799 (7 X 1 mL)

HBV6274 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61799 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61066 (7 X 1 mL)

HBV6275 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61066 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 60409 (8 X 1 mL)

HBV6276 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 60409 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63291 (11 X 1 mL)

HBV6277 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63291 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63426 (10 X 1 mL)

HBV6278 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63426 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63701 (7 X 1 mL)

HBV6279 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63701 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61832 (5 X 1 mL)

HBV6280 5 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61832 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62433 (12 X 1 mL)

HBV6281 12 X 1 mL
EUR 1695.28
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62433 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62675 (14 X 1 mL)

HBV6282 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62675 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62825 (11 X 1 mL)

HBV6283 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62825 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62347 (19 X 1 mL)

HBV6284 19 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62347 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62967 (16 X 1 mL)

HBV6285 16 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62967 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63133 (9 X 1 mL)

HBV6286 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63133 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63253 (11 X 1 mL)

HBV6287 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63253 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63568 (9 X 1 mL)

HBV6288 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63568 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63659 (10 X 1 mL)

HBV6289 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63659 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63997 (12 X 1 mL)

HBV6290 12 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63997 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64121 (8 X 1 mL)

HBV6291 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64121 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64006 (12 X 1 mL)

HBV6292 12 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64006 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64132 (7 X 1 mL)

HBV6293 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64132 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66481 (17 X 1 mL)

HBV9072 17 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66481 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65099 (16 X 1 mL)

HBV9073 16 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65099 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66213 (20 X 1 mL)

HBV9074 20 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66213 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 1034644 (37 X 1 mL)

HBV9092 37 X 1 mL
EUR 2344.24
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 1034644 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 1087380 (31 X 1 mL)

HBV9093 31 X 1 mL
EUR 2344.24
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 1087380 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 74302 (17 X 1 mL)

HBV9098 17 X 1 mL
EUR 1129.52
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 74302 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 75255 (20 X 1 mL)

HBV9099 20 X 1 mL
EUR 1129.52
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 75255 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886.00

IVD antibody

22140-100ul 100ul
EUR 390.00

IVD antibody

70R-18039 50 ul
EUR 435.00
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691.00
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304.00
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-IVD

YF-PA12811 50 ug
EUR 363.00
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403.00
Description: Rabbit polyclonal to IVD

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252.00

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187.00

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308.00

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459.00

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183.00

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223.00

Human IVD Antibody

33170-05111 150 ug
EUR 261.00

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195.00

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585.00
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody

PAab04426 100 ug
EUR 355.00

Anti-IVD antibody

STJ117476 100 µl
EUR 277.00
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510.00

IVD, Human Recombinant

P1577-20 20 µg
EUR 156.00

HemoVoid™ - Hemoglobin Variant Enrichment Kit From Blood

HBV-10 10 preps
EUR 521.00
Description: Hemoglobin Removal Kit

HemoVoid™ - Hemoglobin Variant Enrichment Kit From Blood

HBV-50 50 preps
EUR 1846.00
Description: Hemoglobin Removal Kit

HBV core14, (HBA31)

5-01269 4 x 5mg Ask for price

HBV Core Antibody

20-abx137186
  • EUR 885.00
  • EUR 342.00
  • EUR 1609.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Recombinant HBV Protein

VAng-Lsx0175-1mg 1 mg
EUR 3470.00
Description: HBV, recombinant protein from E. coli.

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103.00

IVD protein (His tag)

80R-1262 100 ug
EUR 268.00
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824.00

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928.00

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689.00

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865.00

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397.00

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for Age-BSA

2221-BSA
EUR 175.00

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224.00
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Anti-HBsAg (HBV) Purified

11-328-C025 0.025 mg
EUR 90.00

Anti-HBsAg (HBV) Purified

11-328-C100 0.1 mg
EUR 140.00

Anti-HBsAg (HBV) Purified

11-329-C025 0.025 mg
EUR 90.00

Anti-HBsAg (HBV) Purified

11-329-C100 0.1 mg
EUR 140.00

HBV Pres 1 antibody

10R-10460 100 ug
EUR 435.00
Description: Mouse monoclonal HBV Pres 1 antibody

HBV Pres 1 antibody

10R-10461 100 ug
EUR 435.00
Description: Mouse monoclonal HBV Pres 1 antibody

HBV core recombinant antigen

00120-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 183 of HBV core antigen 18 kDa

HBV core recombinant antigen

00120-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 183 of HBV core antigen 18 kDa

HBcAg (HBV) (18 - 27)

5-01267 4 x 5mg Ask for price

HBV core (107 - 115)

5-01268 4 x 5mg Ask for price

HBV env (183–191)

5-01271 4 x 5mg Ask for price

HBV env (335 - 343)

5-01272 4 x 5mg Ask for price

HBV polymerase (455 - 463)

5-01273 4 x 5mg Ask for price

HBV-PreS1 (Capture Ab)

abx019238-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

HBV-PreS1 (Capture Ab)

abx019239-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

HBV pre-S1 Protein

20-abx060528
  • EUR 1288.00
  • EUR 2388.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HBV AG-1 Antibody

20-abx137058
  • EUR 356.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HBV AG-2 Antibody

20-abx137059
  • EUR 356.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HBV antigen HBsAg Antibody

abx140205-01mg 0.1 mg
EUR 328.00
  • Shipped within 5-12 working days.

HBV antigen HBsAg Antibody

abx140206-01mg 0.1 mg
EUR 328.00
  • Shipped within 5-12 working days.

HBV core14, (HBA31) Peptide

20-abx266235
  • EUR 467.00
  • EUR 759.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

HBV ELISA KIT|Human

EF007312 96 Tests
EUR 689.00

Human HBV Casse)ELISA

QY-E05334 96T
EUR 361.00

Recombinant HBV Core Antigen

VAng-Wyb8585-inquire inquire Ask for price
Description: Hepatitis B Core Antigen (HBcAg), recombinant protein from E. coli.

Recombinant HBV Core Protein

VAng-Lsx04579-1mg 1 mg
EUR 2236.00
Description: Hepatitis B Core Antigen (HBcAg) Antigen, recombinant protein from E. coli.

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85.00
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85.00
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133.00

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85.00
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232.00

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98.00

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286.00

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164.00

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369.00

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506.00

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95.00

Ivd ORF Vector (Mouse) (pORF)

ORF048200 1.0 ug DNA
EUR 506.00

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA

20021-1 100 ug
EUR 225.00

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-1 100 ug
EUR 225.00

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-2 100 ug
EUR 225.00

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20025-1 100 ug
EUR 225.00

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20026-1 100 ug
EUR 225.00

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20027-1 100 ug
EUR 225.00

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)

MEK1010 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)

MEK1011 1 kit
EUR 1084.00

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)

MEK1012 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)

MEK1013 1 kit
EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)

MEK1015 1 kit
EUR 879.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)

MEK1016 1 kit
EUR 879.00

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column

FAPDE-holder-for-ion-exchange 1 prep
EUR 158.00

HBV core recombinant antigen, Delta

00121-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 144 of HBV core antigen 16 kDa

HBV core recombinant antigen, Delta

00121-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 144 of HBV core antigen 16 kDa

HBV surface recombinant antigen HBsAg

00122-V-01mg 0,1 mg
EUR 267.50
  • Category: Antigens, HBV, Ag
Description: HBV surface recombinant antigen HBsAg antigen 22 kDa Pichia pastoris recombinant

HBV surface recombinant antigen HBsAg

00122-V-1000ug 1000 ug
EUR 1282.50
  • Category: Antigens, HBV, Ag
Description: HBV surface recombinant antigen HBsAg antigen 22 kDa Pichia pastoris recombinant

HBV core protein (128-140)

5-01270 4 x 1mg Ask for price

HBVpol502, HBV polymerase (502 - 510)

5-01274 4 x 5mg Ask for price

HBVpol655, HBV polymerase (655 - 663)

5-01275 4 x 5mg Ask for price

Hepatitis B Virus (HBV) Antibody

20-abx137061
  • EUR 356.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HBV core (107 115) Peptide

20-abx266079
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

HBV polymerase (455 463) Peptide

20-abx266100
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

HBV env (183–191) Peptide

20-abx266128
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

HBV env (335 343) Peptide

20-abx266139
  • EUR 411.00
  • EUR 662.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.