Gemini Genomics

Impact of normal supply of care on receiving smoking cessation recommendation: Korean Nationwide Well being Panel knowledge evaluation

Background: Regardless of numerous anti-smoking insurance policies, the smoking charge in adults continues to be excessive in Korea. Docs’ recommendation is thought to extend the smoking cessation success charge. Nevertheless, few research have reported the impact of getting a normal supply of care (USC) on receiving smoking cessation recommendation.

 

Goal: To find out the impact of USC on receiving smoking cessation recommendation.

 

Strategies: We carried out a number of panel logistic regression analyses to determine the impact of getting a USC on the speed of receiving a health care provider’s smoking cessation recommendation utilizing 2009, 2012 and 2013 datasets from the Korea Well being Panel database. Solely individuals who responded to questions concerning a USC and smoking cessation recommendation have been analysed. Finally, 5243 observations have been included within the ultimate evaluation.

 

Outcomes: A better proportion of individuals with a USC acquired smoking cessation recommendation from medical doctors (58.4% in 2009, 64.0% in 2012 and 59.6% in 2013) than these not having a USC (28.6% in 2009, 37.5% in 2012 and 34.8% in 2013). The percentages ratios (ORs) of receiving smoking cessation recommendation in individuals with a USC have been greater than these of individuals with out a USC after performing a number of panel logistic regression evaluation with random results (OR: 2.24; 95% confidence interval: 1.90-2.63).

 

Conclusions: Having a USC elevated the chances of receiving a health care provider’s smoking cessation recommendation in Koreans. The outcomes of this examine counsel {that a} well being care coverage that encourages having a USC is beneficial in receiving extra smoking cessation recommendation in a Korean inhabitants.

 

Core Panel Multi-Tumor control slides
TS900	Innovex	Set of 5	EUR 218.00

Core Panel Multi-Tumor control slides
TS900-25	Innovex	Set of 25	EUR 485.00

Breast Panel Multi-Tumor control slides
TS901	Innovex	Set of 5	EUR 218.00

Breast Panel Multi-Tumor control slides
TS901-25	Innovex	Set of 25	EUR 485.00

HAV
DAG178	Creative Diagnostics	1 ml	EUR 629.00

Ivd/ Rat Ivd ELISA Kit
ELI-39421r	Lifescience Market	96 Tests	EUR 886.00

HAV HAV P2C recombinant antigen
00165-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

HAV HAV P2C recombinant antigen
00165-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

IVD antibody
22140-100ul	SAB	100ul	EUR 390.00

IVD antibody
70R-18039	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal IVD antibody

IVD antibody
70R-13603	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody
10R-4491	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal IVD antibody

IVD Antibody
DF12284	Affbiotech	200ul	EUR 304.00
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody
1-CSB-PA011921GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody
1-CSB-PA011921LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA
20-abx902738	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

IVD siRNA
20-abx920988	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

IVD siRNA
20-abx920989	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-IVD
YF-PA12811	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to IVD

anti-IVD
YF-PA12812	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to IVD

HAV VP1
DAG1443	Creative Diagnostics	100 µg	EUR 645.00

HAV VP3
DAG1450	Creative Diagnostics	100 µg	EUR 645.00

HAV Protein
abx069838-1ml	Abbexa	1 ml	EUR 314.00
Shipped within 5-10 working days.

HAV Protein
abx069839-1ml	Abbexa	1 ml	EUR 982.00
Shipped within 5-10 working days.

HAV Antigen
E61H00101	EnoGene	1mg	EUR 611.00

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA
BBV15-N-100	Alpha Diagnostics	100 ug	EUR 286.00

IVD Polyclonal Antibody
28898-100ul	SAB	100ul	EUR 252.00

IVD Polyclonal Antibody
28898-50ul	SAB	50ul	EUR 187.00

IVD Rabbit pAb
A15281-100ul	Abclonal	100 ul	EUR 308.00

IVD Rabbit pAb
A15281-200ul	Abclonal	200 ul	EUR 459.00

IVD Rabbit pAb
A15281-20ul	Abclonal	20 ul	EUR 183.00

IVD Rabbit pAb
A15281-50ul	Abclonal	50 ul	EUR 223.00

Human IVD Antibody
33170-05111	AssayPro	150 ug	EUR 261.00

IVD Blocking Peptide
DF12284-BP	Affbiotech	1mg	EUR 195.00

IVD cloning plasmid
CSB-CL011921HU-10ug	Cusabio	10ug	EUR 465.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1272 Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody
FNab04426	FN Test	100µg	EUR 505.25
Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody
FNab04427	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:1000-1:6000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody
PAab04426	Lifescience Market	100 ug	EUR 355.00

Anti-IVD antibody
STJ117476	St John's Laboratory	100 µl	EUR 277.00
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant
P1577-100	Biovision	100 µg	EUR 510.00

IVD, Human Recombinant
P1577-20	Biovision	20 µg	EUR 156.00

Saponin Vaccine Adjuvant
VAdv-Ly0009	Creative Biolabs	1 g	EUR 1095.00
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

HAV VP3 antibody
10R-10488	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HAV VP3 antibody

HAV VP3 antibody
10R-10489	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HAV VP3 antibody

HAV VP1 antibody
10R-10520	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody
10R-10521	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody
10R-10522	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HAV VP1 antibody

HAV P2C-P3A
DAG1448	Creative Diagnostics	100 µg	EUR 645.00

HAV VP2-VP4
DAG1451	Creative Diagnostics	100 µg	EUR 645.00

HAV VP3 Antibody
abx018272-100ug	Abbexa	100 ug	EUR 384.00
Shipped within 5-10 working days.

HAV VP3 Antibody
abx018273-100ug	Abbexa	100 ug	EUR 384.00
Shipped within 5-10 working days.

HAV VP1 Antibody
abx018304-100ug	Abbexa	100 ug	EUR 384.00
Shipped within 5-10 working days.

HAV VP1 Antibody
abx018305-100ug	Abbexa	100 ug	EUR 384.00
Shipped within 5-10 working days.

HAV VP1 Antibody
abx018306-100ug	Abbexa	100 ug	EUR 384.00
Shipped within 5-10 working days.

HAV P3C Protein
abx060523-1mg	Abbexa	1 mg	EUR 1511.00
Shipped within 5-10 working days.

HAV VP1 Protein
abx060524-1mg	Abbexa	1 mg	EUR 1525.00
Shipped within 5-10 working days.

HAV VP3 Protein
abx060526-1mg	Abbexa	1 mg	EUR 1525.00
Shipped within 5-10 working days.

HAV monoclonal antibody
VAnt-Lsx001-1mg	Creative Biolabs	1 mg	EUR 2577.00
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV monoclonal antibody
VAnt-Lsx001-5mg	Creative Biolabs	5mg	EUR 4970.00
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV antibody (HRP)
VAnt-Lsx014-1mg	Creative Biolabs	1 mg	EUR 3268.00
Description: HRP is conjugated to HAV antibody to detect the target molecule.

HAV antibody (HRP)
VAnt-Lsx014-5mg	Creative Biolabs	5mg	EUR 6163.00
Description: HRP is conjugated to HAV antibody to detect the target molecule.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant
AV-7010-50	Alpha Diagnostics	50 ug	EUR 895.00

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)
ELK6188	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)
20011-100	Alpha Diagnostics	100 test	EUR 103.00

IVD protein (His tag)
80R-1262	Fitzgerald	100 ug	EUR 268.00
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT
ELI-12848h	Lifescience Market	96 Tests	EUR 824.00

Bovine IVD ELISA KIT
ELI-13527b	Lifescience Market	96 Tests	EUR 928.00

IVD ELISA KIT|Human
EF010406	Lifescience Market	96 Tests	EUR 689.00

Mouse Ivd ELISA KIT
ELI-43520m	Lifescience Market	96 Tests	EUR 865.00

Mouse IVD shRNA Plasmid
20-abx974716	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat IVD shRNA Plasmid
20-abx984521	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody
C28898	SAB	100ul	EUR 397.00

IVD Antibody, HRP conjugated
1-CSB-PA011921LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated
1-CSB-PA011921LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated
1-CSB-PA011921LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid
20-abx952499	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

IVD Recombinant Protein (Human)
RP016447	ABM	100 ug	Ask for price

IVD Recombinant Protein (Rat)
RP206471	ABM	100 ug	Ask for price

IVD Recombinant Protein (Mouse)
RP144596	ABM	100 ug	Ask for price

BSA Control for Age-BSA
2221-BSA	Biovision		EUR 175.00

BSA Control for AGE-BSA
35R-AA007	Fitzgerald	10 mg	EUR 224.00
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Calcium phosphate vaccine adjuvant
AV-1020-100	Alpha Diagnostics	100 ml	EUR 219.00

Peanut Oil vaccine adjuvant
AV-5010-50	Alpha Diagnostics	50 ml	EUR 225.00

Mineral Oil vaccine adjuvant
AV-5020-50	Alpha Diagnostics	50 ml	EUR 225.00

Mannide monooleate vaccine adjuvant
AV-5030-5	Alpha Diagnostics	5 g	EUR 164.00

HS15 Kolliphore vaccine adjuvant
AV-6010-100	Alpha Diagnostics	100 g	EUR 286.00

Pam2CSK4 vaccine adjuvant, unlabeled
AV-9020-1	Alpha Diagnostics	1 mg	EUR 408.00

Pam3CSK4 vaccine adjuvant, unlabeled
AV-9025-1	Alpha Diagnostics	1 mg	EUR 286.00

Hepatitis A Virus (HAV) antigens (FRhk4, inactivated) for ELISA
HAV15-N-100	Alpha Diagnostics	100 ug	EUR 347.00

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA
HPV618L13-S	Alpha Diagnostics	1 ml	EUR 469.00

HAV P3C recombinant antigen
00162-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV P3C recombinant antigen a.a. 1643-1743.

HAV P3C recombinant antigen
00162-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV P3C recombinant antigen a.a. 1643-1743.

HAV VP3 recombinant antigen
00163-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV VP3 recombinant antigen a.a. 304-415.

HAV VP3 recombinant antigen
00163-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV VP3 recombinant antigen a.a. 304-415.

HAV IgM ELISA Kit
DEIA1012	Creative Diagnostics	96T	EUR 533.00
Description: HAV-IgM ELISA is an enzyme-linked immunosorbent assay for qualitative determination of hepatitis A virus IgM-class antibodies in human serum or plasma samples. The assay is intended to be used in clinical laboratories for diagnosis and management of patients related to infection with hepatitis A virus.

HAV P2C-P3A Protein
abx060522-1mg	Abbexa	1 mg	EUR 1511.00
Shipped within 5-10 working days.

HAV VP1-P2A Protein
abx060525-1mg	Abbexa	1 mg	EUR 1525.00
Shipped within 5-10 working days.

HAV Grade II Concentrate
VAng-0506Lsx-inquire	Creative Biolabs	inquire	Ask for price
Description: HAV Grade II Concentrate from FRhK-4 Cells.

Inactivated HAV Antigen (Monkey)
VAng-Lsx0156-inquire	Creative Biolabs	inquire	Ask for price
Description: HAV, native protein from monkey. Inactivated native Hepatitis A Virus Antigen preparation is inactivated by incubating with formaldehyde for 96 hours.

Inactivated HAV Antigen (Human)
VAng-Lsx0157-1mL	Creative Biolabs	1 mL	EUR 226.00
Description: HAV-Antigen is prepared of the supernatant of infected Wannenstapel and dialysed against phosphat buffered saline.

Recombinant HAV VP3 Protein
VAng-Lsx0167-100g	Creative Biolabs	100 µg	EUR 465.00
Description: HAV VP3, recombinant protein from E. coli.

Recombinant HAV VP3 Protein
VAng-Lsx0167-1mg	Creative Biolabs	1 mg	EUR 2817.00
Description: HAV VP3, recombinant protein from E. coli.

Recombinant HAV VP3 Protein
VAng-Lsx0167-500g	Creative Biolabs	500 µg	EUR 1711.00
Description: HAV VP3, recombinant protein from E. coli.

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T6334035	Biochain	5 slides	EUR 931.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T8334035	Biochain	5 slides	EUR 556.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Rabbit Anti-West Nile Virus vaccine (WNV, Recombitek/DNA vaccine) antiserum
WNV13-S	Alpha Diagnostics	100 ul	EUR 457.00

ELISA kit for Human Hepatitis A Virus IgG (HAV IgG)
KTE62858-48T	Abbkine	48T	EUR 354.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis A Virus IgG (HAV IgG)
KTE62858-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis A Virus IgG (HAV IgG)
KTE62858-96T	Abbkine	96T	EUR 572.00
Description: Quantitative sandwich ELISA for measuring Human Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Hepatitis A Virus IgG (HAV IgG)
KTE71598-48T	Abbkine	48T	EUR 354.00
Description: Quantitative sandwich ELISA for measuring Mouse Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Hepatitis A Virus IgG (HAV IgG)
KTE71598-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252.00
Description: Quantitative sandwich ELISA for measuring Mouse Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Hepatitis A Virus IgG (HAV IgG)
KTE71598-96T	Abbkine	96T	EUR 572.00
Description: Quantitative sandwich ELISA for measuring Mouse Hepatitis A Virus IgG (HAV IgG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Control for DOG1, 3 cases (1.5mm)
DOG1061	Pantomics	1	EUR 85.00
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)
CKIT061	Pantomics	1	EUR 85.00
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)
HRC081	Pantomics	1	EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor
HY-P0301	MedChemExpress	1mg	EUR 133.00

Control for ER, 4 cases (1.5mm)
ERC081	Pantomics	1	EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)
PRC061	Pantomics	1	EUR 85.00
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-100	ScyTek Laboratories	100 Slides	EUR 706.00

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-25	ScyTek Laboratories	25 Slides	EUR 232.00

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-5	ScyTek Laboratories	5 Slides	EUR 98.00

Thiostatin Rat protein, control for western
TSTN11-C	Alpha Diagnostics	100 ul	EUR 286.00

Control/Blocking peptide for Human WNT5a
WNT511-P	Alpha Diagnostics	100 ug	EUR 164.00

Human IVD Antibody (Biotin Conjugate)
33170-05121	AssayPro	150 ug	EUR 369.00

Ivd ORF Vector (Rat) (pORF)
ORF068825	ABM	1.0 ug DNA	EUR 506.00

IVD ORF Vector (Human) (pORF)
ORF005483	ABM	1.0 ug DNA	EUR 95.00

Ivd ORF Vector (Mouse) (pORF)
ORF048200	ABM	1.0 ug DNA	EUR 506.00

Peptidoglycan (S. aureus); vaccine adjuvant
AV-7045-25	Alpha Diagnostics	25 mg	EUR 1017.00

Peptidoglycan (S. aureus); vaccine adjuvant
AV-7045-5	Alpha Diagnostics	5 mg	EUR 286.00

RWJ 21757 Synthetic vaccine adjuvant
AV-9010-1	Alpha Diagnostics	1 mg	EUR 164.00

RWJ 21757 Synthetic vaccine adjuvant
AV-9010-5	Alpha Diagnostics	5 mg	EUR 286.00

Pam2CSK4 vaccine adjuvant; Biotin conjugate
AV-9020-B	Alpha Diagnostics	1 mg	EUR 408.00

Pam2CSK4 vaccine adjuvant; Biotin conjugate
AV-9020-B-100	Alpha Diagnostics	100 ug	EUR 164.00

Pam3CSK4 vaccine adjuvant; Biotin labelled
AV-9025-B	Alpha Diagnostics	100 ug	EUR 347.00

Pam3CSK4 vaccine adjuvant; FITC labelled
AV-9025-F	Alpha Diagnostics	100 ug	EUR 347.00

Pertussis Toxin B.Pertussis, vaccine grade
AV-9130-50	Alpha Diagnostics	50 ug	EUR 529.00

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA
20021-1	Alpha Diagnostics	100 ug	EUR 225.00

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-1	Alpha Diagnostics	100 ug	EUR 225.00

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-2	Alpha Diagnostics	100 ug	EUR 225.00

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20025-1	Alpha Diagnostics	100 ug	EUR 225.00

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20026-1	Alpha Diagnostics	100 ug	EUR 225.00

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20027-1	Alpha Diagnostics	100 ug	EUR 225.00

Rabbit Anti-Gardasil vaccine (merck) antiserum (Human Papilloma Virus 16+18 (HPV16/18) late proteins L1 (HPV16+18L1) control for ELISA
HPV16181-S	Alpha Diagnostics	500 ul	EUR 469.00

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)
MEK1010	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)
MEK1011	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)
MEK1012	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)
MEK1013	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)
MEK1015	BosterBio	1 kit	EUR 879.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)
MEK1016	BosterBio	1 kit	EUR 879.00

HAV VP1-P2A recombinant antigen
00159-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 722-830.

HAV VP1-P2A recombinant antigen
00159-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 722-830.

HAV VP4-VP2 recombinant antigen
00160-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV VP4-VP2 recombinant antigen a.a. 55-164.

HAV VP4-VP2 recombinant antigen
00160-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV VP4-VP2 recombinant antigen a.a. 55-164.

HAV P2C-P3A recombinant antigen
00161-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1492-1606.

HAV P2C-P3A recombinant antigen
00161-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1492-1606.

HAV VP1-P2A recombinant antigen
00164-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 669-782.

HAV VP1-P2A recombinant antigen
00164-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV VP1-P2A recombinant antigen a.a. 669-782.

HAV P2C-P3A recombinant antigen
00166-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1392-1521.

HAV P2C-P3A recombinant antigen
00166-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HAV, Ag
Description: HAV P2C-P3A recombinant antigen a.a. 1392-1521.

Goat Anti-HAV Polyclonal Antibody
DPAB0224	Creative Diagnostics	1 ml	EUR 833.00

HAV P2C (aa 1121 - 1234)
DAG2384	Creative Diagnostics	100 µg	EUR 724.00

HAV P3C (aa 1643 - 1743)
DAG2388	Creative Diagnostics	100 µg	EUR 724.00

HAV VP1 (aa 502 - 605)
DAG3317	Creative Diagnostics	100 µg	EUR 810.00

Anti-HAV IgG ELISA Kit
DEIA007	Creative Diagnostics	96T	EUR 485.00
Description: Human HAV-IgG ELISA Kit is an enzyme linked-immunosorbent assay (ELISA) for qualitative detection of IgG-class antibodies to hepatitis A virus in human serum or plasma. It is intended for use in clinical laboratories for diagnosis and monitoring of patients related to infection with hepatitis A virus.

Anti-HAV IgM ELISA Kit
DEIA008	Creative Diagnostics	96T	EUR 723.00
Description: HAV-IgM ELISA is an enzyme-linked immunosorbent assay for qualitative determination of hepatitis A virus IgM-class antibodies in human serum or plasma samples. The assay is intended to be used in clinical laboratories for diagnosis and management of patients related to infection with hepatitis A virus.

HAV antibody IgM ELISA test
75	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HAV antibody IgM

Hepatitis A Virus (HAV) Antibody
abx024089-1mg	Abbexa	1 mg	EUR 1177.00
Shipped within 5-10 working days.

Hepatitis A Virus (HAV) Antibody
abx024090-1mg	Abbexa	1 mg	EUR 1177.00
Shipped within 5-10 working days.

Hepatitis A Virus (HAV) Antibody
abx024091-1mg	Abbexa	1 mg	EUR 1177.00
Shipped within 5-10 working days.

Human Anti-HAV ELISA Kit
EHA0822	Abclonal	96Tests	EUR 521.00

Human HAV IgA ELISA Kit
EHH0031	Abclonal	96Tests	EUR 521.00

Human HAV IgG ELISA Kit
EHH0032	Abclonal	96Tests	EUR 521.00

Human HAV IgM ELISA Kit
EHH0033	Abclonal	96Tests	EUR 521.00

Human HAV IgD ELISA Kit
EHH0034	Abclonal	96Tests	EUR 521.00

Goat Anti-HAV ELISA Kit
EGTA0822	Abclonal	96Tests	EUR 521.00

Goat HAV IgA ELISA Kit
EGTH0031	Abclonal	96Tests	EUR 521.00

Goat HAV IgG ELISA Kit
EGTH0032	Abclonal	96Tests	EUR 521.00

Goat HAV IgM ELISA Kit
EGTH0033	Abclonal	96Tests	EUR 521.00

Goat HAV IgD ELISA Kit
EGTH0034	Abclonal	96Tests	EUR 521.00

Bovine Anti-HAV ELISA Kit
EBA0822	Abclonal	96Tests	EUR 521.00

Bovine HAV IgA ELISA Kit
EBH0031	Abclonal	96Tests	EUR 521.00

Bovine HAV IgG ELISA Kit
EBH0032	Abclonal	96Tests	EUR 521.00

Bovine HAV IgM ELISA Kit
EBH0033	Abclonal	96Tests	EUR 521.00

Bovine HAV IgD ELISA Kit
EBH0034	Abclonal	96Tests	EUR 521.00

Canine Anti-HAV ELISA Kit
ECA0822	Abclonal	96Tests	EUR 521.00

Canine HAV IgA ELISA Kit
ECH0031	Abclonal	96Tests	EUR 521.00

 

Consciousness of and Attitudes Towards Consumer Involvement in Analysis on Growing old and Well being: Protocol for a Quantitative Giant-Scale Panel Examine

Background: Consumer involvement is a requirement of most analysis funders. There’s a rising physique of literature exploring the advantages and challenges of consumer involvement in analysis, however such research are scarce within the subject of growing old and well being.

 

Furthermore, the vast majority of such analysis is qualitative, which limits the generalizability of outcomes. The UserAge panel examine can be instrumental in increasing data that may profit the standard and impression of consumer involvement in future analysis.

 

Goal: The goal of this examine is to find out the attention and understanding of and attitudes towards consumer involvement in analysis amongst totally different classes of information customers and researchers over time.

 

Strategies: A panel examine can be applied with three totally different classes of information customers (individuals aged 60 years and older, casual carers, and professionals in well being care and structure) and researchers in growing old and well being.

• An expert survey firm will acquire knowledge from all samples in parallel. Potential members can be requested to finish the survey by way of phone or on-line, or members can request a paper survey to be despatched to them within the submit. A draft set of questions on attitudes and behavioral patterns associated to analysis utilization and consumer involvement in analysis was compiled based mostly on present literature and enter from the analysis crew.
• Utilizing a participatory strategy, we engaged a consumer discussion board, the place Eight older individuals and three researchers collectively refined the survey for time/size to finish, terminology, readability, and context. Information collected by way of the web or phone can be robotically processed, and knowledge collected on paper kinds can be entered in machine-readable kinds.
• The survey firm will retailer all knowledge and ship the quality-controlled database to the college for additional storage. Analyses of frequencies and measures of central tendency can be used for descriptive functions. To check teams, state-of-the artwork statistical analyses can be used.

 

Outcomes: Information assortment for the primary examine wave began in September 2019 and can be accomplished in spring 2020. Information can be prepared for evaluation following cleansing and high quality management, which began throughout summer season 2020 and can be accomplished autumn 2020. We anticipate the info assortment for the second examine wave to start out in September 2021.

 

Conclusions: That is the primary quantitative large-scale panel examine specializing in tendencies in attitudes towards, consciousness of, and data about consumer involvement in analysis on growing old and well being in Sweden. The outcomes will generate new and vital data to advance the understanding of consumer wants and preferences in addition to the relevance of consumer involvement in analysis on growing old and well being.

 

HBV LONGITUDINAL PANEL (12 X 1 mL)
6548	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)
6501	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (15 X 1 mL)
6512	Zeptometrix	15 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)
6516	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)
6518	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)
6528	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)
6529	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)
6538	Zeptometrix	12 X 1 mL	EUR 1261.60
What is the product classification? HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Positive control tissue section for each antibody; Based on availability INQUIRE
Control-Slides	Innovex	Set of 5	EUR 176.00

Core Panel Multi-Tumor control slides
TS900	Innovex	Set of 5	EUR 218.00

Core Panel Multi-Tumor control slides
TS900-25	Innovex	Set of 25	EUR 485.00

Breast Panel Multi-Tumor control slides
TS901	Innovex	Set of 5	EUR 218.00

Breast Panel Multi-Tumor control slides
TS901-25	Innovex	Set of 25	EUR 485.00

HBV Seroconversion Panel Donor# 64090 (5 X 1 mL)
HBV10231	Zeptometrix	5 X 1 mL	EUR 582.48
What is the product classification? HBV Seroconversion Panel Donor# 64090 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64017 (6 X 1 mL)
HBV10232	Zeptometrix	6 X 1 mL	EUR 582.48
What is the product classification? HBV Seroconversion Panel Donor# 64017 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65449 (9 X 1 mL)
HBV11000	Zeptometrix	9 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65524 (8 X 1 mL)
HBV11001	Zeptometrix	8 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65524 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65556 (6 X 1 mL)
HBV11002	Zeptometrix	6 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65556 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65584 (8 X 1 mL)
HBV11003	Zeptometrix	8 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65584 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65732 (8 X 1 mL)
HBV11004	Zeptometrix	8 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65732 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65777 (14 X 1 mL)
HBV11005	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65777 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66201 (17 X 1 mL)
HBV11006	Zeptometrix	17 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 66201 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66537 (14 X 1 mL)
HBV11007	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 66537 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67303 (18 X 1 mL)
HBV11008	Zeptometrix	18 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 67303 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67449 (23 X 1 mL)
HBV11009	Zeptometrix	23 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 67449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67457 (18 X 1 mL)
HBV11010	Zeptometrix	18 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 67457 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67694 (14 X 1 mL)
HBV11011	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 67694 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67773 (6 X 1 mL)
HBV11012	Zeptometrix	6 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 67773 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67962 (35 X 1 mL)
HBV11013	Zeptometrix	35 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 67962 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68029 (12 X 1 mL)
HBV11014	Zeptometrix	12 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 68029 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68105 (14 X 1 mL)
HBV11015	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 68105 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68541 (10 X 1 mL)
HBV11016	Zeptometrix	10 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 68541 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68739 (14 X 1 mL)
HBV11017	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 68739 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70793 (14 X 1 mL)
HBV11024	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 70793 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70970 (16 X 1 mL)
HBV11026	Zeptometrix	16 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 70970 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71415 (13 X 1 mL)
HBV11027	Zeptometrix	13 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 71415 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71840 (10 X 1 mL)
HBV11028	Zeptometrix	10 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 71840 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 69751 (13 X 1 mL)
HBV11029	Zeptometrix	13 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 69751 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70292 (15 X 1 mL)
HBV11031	Zeptometrix	15 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 70292 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72439 (13 X 1 mL)
HBV11052	Zeptometrix	13 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 72439 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72474 (11 X 1 mL)
HBV11056	Zeptometrix	11 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 72474 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71612 (8 X 1 mL)
HBV11058	Zeptometrix	8 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 71612 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72324 (9 X 1 mL)
HBV11059	Zeptometrix	9 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 72324 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71922 (11 X 1 mL)
HBV11062	Zeptometrix	11 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 71922 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71782 (9 X 1 mL)
HBV11064	Zeptometrix	9 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 71782 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 73299 (15 X 1 mL)
HBV11069	Zeptometrix	15 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 73299 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61248 (5 X 1 mL)
HBV6271	Zeptometrix	5 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 61248 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61291 (25 X 1 mL)
HBV6272	Zeptometrix	25 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 61291 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61042 (6 X 1 mL)
HBV6273	Zeptometrix	6 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 61042 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61799 (7 X 1 mL)
HBV6274	Zeptometrix	7 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 61799 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61066 (7 X 1 mL)
HBV6275	Zeptometrix	7 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 61066 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 60409 (8 X 1 mL)
HBV6276	Zeptometrix	8 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 60409 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63291 (11 X 1 mL)
HBV6277	Zeptometrix	11 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63291 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63426 (10 X 1 mL)
HBV6278	Zeptometrix	10 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63426 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63701 (7 X 1 mL)
HBV6279	Zeptometrix	7 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63701 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61832 (5 X 1 mL)
HBV6280	Zeptometrix	5 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 61832 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62433 (12 X 1 mL)
HBV6281	Zeptometrix	12 X 1 mL	EUR 1695.28
What is the product classification? HBV Seroconversion Panel Donor# 62433 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62675 (14 X 1 mL)
HBV6282	Zeptometrix	14 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 62675 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62825 (11 X 1 mL)
HBV6283	Zeptometrix	11 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 62825 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62347 (19 X 1 mL)
HBV6284	Zeptometrix	19 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 62347 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62967 (16 X 1 mL)
HBV6285	Zeptometrix	16 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 62967 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63133 (9 X 1 mL)
HBV6286	Zeptometrix	9 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63133 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63253 (11 X 1 mL)
HBV6287	Zeptometrix	11 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63253 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63568 (9 X 1 mL)
HBV6288	Zeptometrix	9 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63568 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63659 (10 X 1 mL)
HBV6289	Zeptometrix	10 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63659 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63997 (12 X 1 mL)
HBV6290	Zeptometrix	12 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 63997 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64121 (8 X 1 mL)
HBV6291	Zeptometrix	8 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 64121 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64006 (12 X 1 mL)
HBV6292	Zeptometrix	12 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 64006 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64132 (7 X 1 mL)
HBV6293	Zeptometrix	7 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 64132 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66481 (17 X 1 mL)
HBV9072	Zeptometrix	17 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 66481 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65099 (16 X 1 mL)
HBV9073	Zeptometrix	16 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 65099 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66213 (20 X 1 mL)
HBV9074	Zeptometrix	20 X 1 mL	EUR 859.12
What is the product classification? HBV Seroconversion Panel Donor# 66213 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 1034644 (37 X 1 mL)
HBV9092	Zeptometrix	37 X 1 mL	EUR 2344.24
What is the product classification? HBV Seroconversion Panel Donor# 1034644 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 1087380 (31 X 1 mL)
HBV9093	Zeptometrix	31 X 1 mL	EUR 2344.24
What is the product classification? HBV Seroconversion Panel Donor# 1087380 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 74302 (17 X 1 mL)
HBV9098	Zeptometrix	17 X 1 mL	EUR 1129.52
What is the product classification? HBV Seroconversion Panel Donor# 74302 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 75255 (20 X 1 mL)
HBV9099	Zeptometrix	20 X 1 mL	EUR 1129.52
What is the product classification? HBV Seroconversion Panel Donor# 75255 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Ivd/ Rat Ivd ELISA Kit
ELI-39421r	Lifescience Market	96 Tests	EUR 886.00

IVD antibody
22140-100ul	SAB	100ul	EUR 390.00

IVD antibody
70R-18039	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal IVD antibody

IVD antibody
70R-13603	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody
10R-4491	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal IVD antibody

IVD Antibody
DF12284	Affbiotech	200ul	EUR 304.00
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody
1-CSB-PA011921GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody
1-CSB-PA011921LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA
20-abx902738	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

IVD siRNA
20-abx920988	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

IVD siRNA
20-abx920989	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-IVD
YF-PA12811	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to IVD

anti-IVD
YF-PA12812	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to IVD

IVD Polyclonal Antibody
28898-100ul	SAB	100ul	EUR 252.00

IVD Polyclonal Antibody
28898-50ul	SAB	50ul	EUR 187.00

IVD Rabbit pAb
A15281-100ul	Abclonal	100 ul	EUR 308.00

IVD Rabbit pAb
A15281-200ul	Abclonal	200 ul	EUR 459.00

IVD Rabbit pAb
A15281-20ul	Abclonal	20 ul	EUR 183.00

IVD Rabbit pAb
A15281-50ul	Abclonal	50 ul	EUR 223.00

Human IVD Antibody
33170-05111	AssayPro	150 ug	EUR 261.00

IVD Blocking Peptide
DF12284-BP	Affbiotech	1mg	EUR 195.00

IVD cloning plasmid
CSB-CL011921HU-10ug	Cusabio	10ug	EUR 465.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1272 Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody
FNab04426	FN Test	100µg	EUR 505.25
Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody
FNab04427	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:1000-1:6000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody
PAab04426	Lifescience Market	100 ug	EUR 355.00

Anti-IVD antibody
STJ117476	St John's Laboratory	100 µl	EUR 277.00
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant
P1577-100	Biovision	100 µg	EUR 510.00

IVD, Human Recombinant
P1577-20	Biovision	20 µg	EUR 156.00

HemoVoid™ - Hemoglobin Variant Enrichment Kit From Blood
HBV-10	Biotech Support Group	10 preps	EUR 521.00
Description: Hemoglobin Removal Kit

HemoVoid™ - Hemoglobin Variant Enrichment Kit From Blood
HBV-50	Biotech Support Group	50 preps	EUR 1846.00
Description: Hemoglobin Removal Kit

HBV core14, (HBA31)
5-01269	CHI Scientific	4 x 5mg	Ask for price

HBV Core Antibody
20-abx137186	Abbexa	EUR 885.00 EUR 342.00 EUR 1609.00	0 1 2
Shipped within 5-10 working days.

Recombinant HBV Protein
VAng-Lsx0175-1mg	Creative Biolabs	1 mg	EUR 3470.00
Description: HBV, recombinant protein from E. coli.

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)
ELK6188	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)
20011-100	Alpha Diagnostics	100 test	EUR 103.00

IVD protein (His tag)
80R-1262	Fitzgerald	100 ug	EUR 268.00
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT
ELI-12848h	Lifescience Market	96 Tests	EUR 824.00

Bovine IVD ELISA KIT
ELI-13527b	Lifescience Market	96 Tests	EUR 928.00

IVD ELISA KIT|Human
EF010406	Lifescience Market	96 Tests	EUR 689.00

Mouse Ivd ELISA KIT
ELI-43520m	Lifescience Market	96 Tests	EUR 865.00

Mouse IVD shRNA Plasmid
20-abx974716	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat IVD shRNA Plasmid
20-abx984521	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody
C28898	SAB	100ul	EUR 397.00

IVD Antibody, HRP conjugated
1-CSB-PA011921LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated
1-CSB-PA011921LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated
1-CSB-PA011921LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid
20-abx952499	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

IVD Recombinant Protein (Human)
RP016447	ABM	100 ug	Ask for price

IVD Recombinant Protein (Rat)
RP206471	ABM	100 ug	Ask for price

IVD Recombinant Protein (Mouse)
RP144596	ABM	100 ug	Ask for price

BSA Control for Age-BSA
2221-BSA	Biovision		EUR 175.00

BSA Control for AGE-BSA
35R-AA007	Fitzgerald	10 mg	EUR 224.00
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T6334035	Biochain	5 slides	EUR 931.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T8334035	Biochain	5 slides	EUR 556.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Anti-HBsAg (HBV) Purified
11-328-C025	ExBio	0.025 mg	EUR 90.00

Anti-HBsAg (HBV) Purified
11-328-C100	ExBio	0.1 mg	EUR 140.00

Anti-HBsAg (HBV) Purified
11-329-C025	ExBio	0.025 mg	EUR 90.00

Anti-HBsAg (HBV) Purified
11-329-C100	ExBio	0.1 mg	EUR 140.00

HBV Pres 1 antibody
10R-10460	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HBV Pres 1 antibody

HBV Pres 1 antibody
10R-10461	Fitzgerald	100 ug	EUR 435.00
Description: Mouse monoclonal HBV Pres 1 antibody

HBV core recombinant antigen
00120-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 183 of HBV core antigen 18 kDa

HBV core recombinant antigen
00120-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 183 of HBV core antigen 18 kDa

HBcAg (HBV) (18 - 27)
5-01267	CHI Scientific	4 x 5mg	Ask for price

HBV core (107 - 115)
5-01268	CHI Scientific	4 x 5mg	Ask for price

HBV env (183–191)
5-01271	CHI Scientific	4 x 5mg	Ask for price

HBV env (335 - 343)
5-01272	CHI Scientific	4 x 5mg	Ask for price

HBV polymerase (455 - 463)
5-01273	CHI Scientific	4 x 5mg	Ask for price

HBV-PreS1 (Capture Ab)
abx019238-1mg	Abbexa	1 mg	EUR 453.00
Shipped within 5-10 working days.

HBV-PreS1 (Capture Ab)
abx019239-1mg	Abbexa	1 mg	EUR 453.00
Shipped within 5-10 working days.

HBV pre-S1 Protein
20-abx060528	Abbexa	EUR 1288.00 EUR 2388.00	0 1
Shipped within 5-10 working days.

HBV AG-1 Antibody
20-abx137058	Abbexa	EUR 356.00 EUR 523.00	0 1
Shipped within 5-10 working days.

HBV AG-2 Antibody
20-abx137059	Abbexa	EUR 356.00 EUR 523.00	0 1
Shipped within 5-10 working days.

HBV antigen HBsAg Antibody
abx140205-01mg	Abbexa	0.1 mg	EUR 328.00
Shipped within 5-12 working days.

HBV antigen HBsAg Antibody
abx140206-01mg	Abbexa	0.1 mg	EUR 328.00
Shipped within 5-12 working days.

HBV core14, (HBA31) Peptide
20-abx266235	Abbexa	EUR 467.00 EUR 759.00 EUR 342.00	0 1 2
Shipped within 5-10 working days.

HBV ELISA KIT|Human
EF007312	Lifescience Market	96 Tests	EUR 689.00

Human HBV Casse）ELISA
QY-E05334	Qayee Biotechnology	96T	EUR 361.00

Recombinant HBV Core Antigen
VAng-Wyb8585-inquire	Creative Biolabs	inquire	Ask for price
Description: Hepatitis B Core Antigen (HBcAg), recombinant protein from E. coli.

Recombinant HBV Core Protein
VAng-Lsx04579-1mg	Creative Biolabs	1 mg	EUR 2236.00
Description: Hepatitis B Core Antigen (HBcAg) Antigen, recombinant protein from E. coli.

Control for DOG1, 3 cases (1.5mm)
DOG1061	Pantomics	1	EUR 85.00
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)
CKIT061	Pantomics	1	EUR 85.00
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for HER2, 4 cases (1.5mm)
HRC081	Pantomics	1	EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor
HY-P0301	MedChemExpress	1mg	EUR 133.00

Control for ER, 4 cases (1.5mm)
ERC081	Pantomics	1	EUR 85.00
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

Control for PR, 3 cases (1.5mm)
PRC061	Pantomics	1	EUR 85.00
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-100	ScyTek Laboratories	100 Slides	EUR 706.00

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-25	ScyTek Laboratories	25 Slides	EUR 232.00

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-5	ScyTek Laboratories	5 Slides	EUR 98.00

Thiostatin Rat protein, control for western
TSTN11-C	Alpha Diagnostics	100 ul	EUR 286.00

Control/Blocking peptide for Human WNT5a
WNT511-P	Alpha Diagnostics	100 ug	EUR 164.00

Human IVD Antibody (Biotin Conjugate)
33170-05121	AssayPro	150 ug	EUR 369.00

Ivd ORF Vector (Rat) (pORF)
ORF068825	ABM	1.0 ug DNA	EUR 506.00

IVD ORF Vector (Human) (pORF)
ORF005483	ABM	1.0 ug DNA	EUR 95.00

Ivd ORF Vector (Mouse) (pORF)
ORF048200	ABM	1.0 ug DNA	EUR 506.00

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA
20021-1	Alpha Diagnostics	100 ug	EUR 225.00

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-1	Alpha Diagnostics	100 ug	EUR 225.00

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-2	Alpha Diagnostics	100 ug	EUR 225.00

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20025-1	Alpha Diagnostics	100 ug	EUR 225.00

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20026-1	Alpha Diagnostics	100 ug	EUR 225.00

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20027-1	Alpha Diagnostics	100 ug	EUR 225.00

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)
MEK1010	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)
MEK1011	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)
MEK1012	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)
MEK1013	BosterBio	1 kit	EUR 1084.00

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)
MEK1015	BosterBio	1 kit	EUR 879.00

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)
MEK1016	BosterBio	1 kit	EUR 879.00

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column
FAPDE-holder-for-ion-exchange	Favorgen	1 prep	EUR 158.00

HBV core recombinant antigen, Delta
00121-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 144 of HBV core antigen 16 kDa

HBV core recombinant antigen, Delta
00121-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HBV, Ag
Description: HBV core recombinant antigen HBcAg a.a 1 to a.a 144 of HBV core antigen 16 kDa

HBV surface recombinant antigen HBsAg
00122-V-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antigens, HBV, Ag
Description: HBV surface recombinant antigen HBsAg antigen 22 kDa Pichia pastoris recombinant

HBV surface recombinant antigen HBsAg
00122-V-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antigens, HBV, Ag
Description: HBV surface recombinant antigen HBsAg antigen 22 kDa Pichia pastoris recombinant

HBV core protein (128-140)
5-01270	CHI Scientific	4 x 1mg	Ask for price

HBVpol502, HBV polymerase (502 - 510)
5-01274	CHI Scientific	4 x 5mg	Ask for price

HBVpol655, HBV polymerase (655 - 663)
5-01275	CHI Scientific	4 x 5mg	Ask for price

Hepatitis B Virus (HBV) Antibody
20-abx137061	Abbexa	EUR 356.00 EUR 523.00	0 1
Shipped within 5-10 working days.

HBV core (107 115) Peptide
20-abx266079	Abbexa	EUR 411.00 EUR 662.00 EUR 314.00	0 1 2
Shipped within 5-10 working days.

HBV polymerase (455 463) Peptide
20-abx266100	Abbexa	EUR 411.00 EUR 662.00 EUR 314.00	0 1 2
Shipped within 5-10 working days.

HBV env (183–191) Peptide
20-abx266128	Abbexa	EUR 411.00 EUR 662.00 EUR 314.00	0 1 2
Shipped within 5-10 working days.

HBV env (335 343) Peptide
20-abx266139	Abbexa	EUR 411.00 EUR 662.00 EUR 314.00	0 1 2
Shipped within 5-10 working days.