ST8SIA5

ST8SIA5 siRNA
20-abx935355
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST8SIA5 Antibody
1-CSB-PA022778LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA5. Recognizes ST8SIA5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
ST8SIA5 Antibody (HRP)
20-abx305442
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA5 Antibody (FITC)
20-abx305443
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA5 Antibody (Biotin)
20-abx305444
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA5 Polyclonal Antibody
A63504 100 µg
EUR 570.55
Description: Ask the seller for details
ST8SIA5 cloning plasmid
CSB-CL022778HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1131
  • Sequence: ATGCGCTACGCGGACCCCTCGGCCAACCGGGATTTGTTGGGGAGCCGAACTTTGCTCTTCATCTTCATCTGCGCCTTTGCCTTGGTGACCTTGCTGCAACAGATCCTGTATGGCAGGAACTACATTAAGAGGTACTTTGAATTTTATGAGGGGCCTTTTGAATATAACTCCACAA
  • Show more
Description: A cloning plasmid for the ST8SIA5 gene.
Human ST8SIA5 shRNA Plasmid
20-abx959260
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ST8SIA5 shRNA Plasmid
20-abx981422
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST8SIA5 Antibody, HRP conjugated
1-CSB-PA022778LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA5. Recognizes ST8SIA5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST8SIA5 Antibody, FITC conjugated
1-CSB-PA022778LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA5. Recognizes ST8SIA5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST8SIA5 Antibody, Biotin conjugated
1-CSB-PA022778LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA5. Recognizes ST8SIA5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ST8SIA5 Recombinant Protein (Rat)
RP231287 100 ug Ask for price
ST8SIA5 Recombinant Protein (Human)
RP043798 100 ug Ask for price
ST8SIA5 Recombinant Protein (Mouse)
RP175844 100 ug Ask for price
ST8SIA5 Recombinant Protein (Mouse)
RP175847 100 ug Ask for price
ST8SIA5 Polyclonal Antibody, HRP Conjugated
A63505 100 µg
EUR 570.55
Description: The best epigenetics products
ST8SIA5 Polyclonal Antibody, FITC Conjugated
A63506 100 µg
EUR 570.55
Description: kits suitable for this type of research
ST8SIA5 Polyclonal Antibody, Biotin Conjugated
A63507 100 µg
EUR 570.55
Description: fast delivery possible
ST8SIA5 ORF Vector (Human) (pORF)
ORF014600 1.0 ug DNA
EUR 354.00
St8sia5 ORF Vector (Mouse) (pORF)
ORF058616 1.0 ug DNA
EUR 506.00
St8sia5 ORF Vector (Mouse) (pORF)
ORF058617 1.0 ug DNA
EUR 506.00
St8sia5 ORF Vector (Rat) (pORF)
ORF077097 1.0 ug DNA
EUR 506.00
Alpha-2,8-Sialyltransferase 8E (ST8SIA5) Antibody
20-abx302942
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA5 sgRNA CRISPR Lentivector set (Human)
K2296801 3 x 1.0 ug
EUR 339.00
St8sia5 sgRNA CRISPR Lentivector set (Rat)
K7358501 3 x 1.0 ug
EUR 339.00
St8sia5 sgRNA CRISPR Lentivector set (Mouse)
K4163901 3 x 1.0 ug
EUR 339.00
ST8SIA5 Protein Vector (Human) (pPB-C-His)
PV058397 500 ng
EUR 481.00
ST8SIA5 Protein Vector (Human) (pPB-N-His)
PV058398 500 ng
EUR 481.00
ST8SIA5 Protein Vector (Human) (pPM-C-HA)
PV058399 500 ng
EUR 481.00
ST8SIA5 Protein Vector (Human) (pPM-C-His)
PV058400 500 ng
EUR 481.00
ST8SIA5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2296802 1.0 ug DNA
EUR 154.00
ST8SIA5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2296803 1.0 ug DNA
EUR 154.00
ST8SIA5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2296804 1.0 ug DNA
EUR 154.00
St8sia5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7358502 1.0 ug DNA
EUR 154.00
St8sia5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7358503 1.0 ug DNA
EUR 154.00
St8sia5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7358504 1.0 ug DNA
EUR 154.00
St8sia5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4163902 1.0 ug DNA
EUR 154.00
St8sia5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4163903 1.0 ug DNA
EUR 154.00
St8sia5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4163904 1.0 ug DNA
EUR 154.00
ST8SIA5 3'UTR Luciferase Stable Cell Line
TU024728 1.0 ml
EUR 1394.00
ST8SIA5 Protein Vector (Rat) (pPB-C-His)
PV308386 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Rat) (pPB-N-His)
PV308387 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Rat) (pPM-C-HA)
PV308388 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Rat) (pPM-C-His)
PV308389 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPB-C-His)
PV234462 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPB-N-His)
PV234463 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPM-C-HA)
PV234464 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPM-C-His)
PV234465 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPB-C-His)
PV234466 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPB-N-His)
PV234467 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPM-C-HA)
PV234468 500 ng
EUR 603.00
ST8SIA5 Protein Vector (Mouse) (pPM-C-His)
PV234469 500 ng
EUR 603.00
St8sia5 3'UTR Luciferase Stable Cell Line
TU221255 1.0 ml Ask for price
ST8SIA5 3'UTR GFP Stable Cell Line
TU074728 1.0 ml
EUR 1394.00
St8sia5 3'UTR GFP Stable Cell Line
TU271255 1.0 ml Ask for price
St8sia5 3'UTR GFP Stable Cell Line
TU169789 1.0 ml Ask for price
St8sia5 3'UTR Luciferase Stable Cell Line
TU119789 1.0 ml Ask for price
Human Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E01A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E01A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E01A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E02A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E02A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E02A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E06A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E06A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E06A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E08A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E08A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E08A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha- 2,8- sialyltransferase 8E, St8sia5 ELISA KIT
ELI-53246m 96 Tests
EUR 865.00
Pig Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E07A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E07A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E07A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E03A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E03A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E03A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E04A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E04A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E04A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha- 2,8- sialyltransferase 8E, ST8SIA5 ELISA KIT
ELI-19863h 96 Tests
EUR 824.00
Monkey Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E09A1999-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E09A1999-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha 2,8 sialyltransferase 8E(ST8SIA5) ELISA kit
E09A1999-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alpha 2,8 sialyltransferase 8E(ST8SIA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ST8SIA5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV634063 1.0 ug DNA
EUR 682.00