RAB38 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB38. Recognizes RAB38 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

RAB38 Antibody

DF4404 200ul
EUR 304
Description: RAB38 Antibody detects endogenous levels of total RAB38.

RAB38 antibody

70R-50907 100 ul
EUR 244
Description: Purified Polyclonal RAB38 antibody

RAB38 antibody

70R-5865 50 ug
EUR 467
Description: Rabbit polyclonal RAB38 antibody raised against the N terminal of RAB38

RAB38 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB38. Recognizes RAB38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

RAB38 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB38. Recognizes RAB38 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB38 Antibody

ABD4404 100 ug
EUR 438


YF-PA18039 50 ug
EUR 363
Description: Mouse polyclonal to RAB38


YF-PA18040 100 ul
EUR 403
Description: Rabbit polyclonal to RAB38


YF-PA25924 50 ul
EUR 334
Description: Mouse polyclonal to RAB38

RAB38, Member RAS Oncogene Family (RAB38) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

abx122939-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

abx122310-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

abx237021-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB38, Member RAS Oncogene Family (RAB38) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RAB38 Antibody

A05500 100ul
EUR 397
Description: Rabbit Polyclonal RAB38 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RAB38 Blocking Peptide

33R-6318 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB38 antibody, catalog no. 70R-5865

RAB38 Blocking Peptide

DF4404-BP 1mg
EUR 195

RAB38 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB38 Conjugated Antibody

C36736 100ul
EUR 397

RAB38 cloning plasmid

CSB-CL019191HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 636
  • Sequence: atgcaggccccgcacaaggagcacctgtacaagttgctggtgattggcgacctgggcgtggggaagaccagtatcatcaagcgctacgtgcaccagaacttctcctcgcactaccgggccacaatcggcgtggacttcgcgctcaaggtgctccactgggacccggagactgtggt
  • Show more
Description: A cloning plasmid for the RAB38 gene.

RAB38 Polyclonal Antibody

A60494 100 µg
EUR 570.55
Description: reagents widely cited

RAB38 Rabbit pAb

A16505-100ul 100 ul
EUR 308

RAB38 Rabbit pAb

A16505-200ul 200 ul
EUR 459

RAB38 Rabbit pAb

A16505-20ul 20 ul
EUR 183

RAB38 Rabbit pAb

A16505-50ul 50 ul
EUR 223

anti- RAB38 antibody

FNab07021 100µg
EUR 585
  • Immunogen: RAB38, member RAS oncogene family
  • Uniprot ID: P57729
  • Gene ID: 23682
  • Research Area: Signal Transduction
Description: Antibody raised against RAB38

anti-RAB38 (7F1)

LF-MA10269 100 ug
EUR 363
Description: Mouse monoclonal to RAB38

Anti-RAB38 antibody

PAab07021 100 ug
EUR 412


PVT13261 2 ug
EUR 391

Anti-RAB38 antibody

STJ118944 100 µl
EUR 277

Anti-Rab38 antibody

STJ140135 200 µg
EUR 408
Description: Goat polyclonal antibody to Rab38. Rab38 belongs to the small GTPase superfamily, Rab family. The protein is membrane-bound and involved in intracellular vesicle transport and small GTPase mediated signal transduction.

Anti-RAB38 (1H8)

YF-MA17973 200 ul
EUR 363
Description: Mouse monoclonal to RAB38


EF002237 96 Tests
EUR 689

Mouse RAB38 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB38 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB38. Recognizes RAB38 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB38 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB38. Recognizes RAB38 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB38 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB38. Recognizes RAB38 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RAB38 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB38 Recombinant Protein (Human)

RP025492 100 ug Ask for price

RAB38 Recombinant Protein (Mouse)

RP166292 100 ug Ask for price

RAB38 Recombinant Protein (Rat)

RP223328 100 ug Ask for price

Polyclonal RAB38 Antibody (aa80-129)

AMM07471G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB38 (aa80-129). This antibody is tested and proven to work in the following applications:

RAB38 Polyclonal Antibody, Biotin Conjugated

A60495 100 µg
EUR 570.55
Description: Ask the seller for details

RAB38 Polyclonal Antibody, FITC Conjugated

A60496 100 µg
EUR 570.55
Description: The best epigenetics products

RAB38 Polyclonal Antibody, HRP Conjugated

A60497 100 µg
EUR 570.55
Description: kits suitable for this type of research

Rab38 ORF Vector (Rat) (pORF)

ORF074444 1.0 ug DNA
EUR 506

RAB38 ORF Vector (Human) (pORF)

ORF008498 1.0 ug DNA
EUR 95

Rab38 ORF Vector (Mouse) (pORF)

ORF055432 1.0 ug DNA
EUR 506

Polyclonal RAB38 antibody - N-terminal region

AMM07473G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB38 - N-terminal region. This antibody is tested and proven to work in the following applications:

Rab38 sgRNA CRISPR Lentivector set (Rat)

K7358401 3 x 1.0 ug
EUR 339

Rab38 sgRNA CRISPR Lentivector set (Mouse)

K4062501 3 x 1.0 ug
EUR 339

RAB38 sgRNA CRISPR Lentivector set (Human)

K1774101 3 x 1.0 ug
EUR 339

Monoclonal RAB38 Antibody (monoclonal) (M02), Clone: 7F1

AMM07472G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAB38 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 7F1. This antibody is applicable in WB, E

Rab38 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7358402 1.0 ug DNA
EUR 154

Rab38 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7358403 1.0 ug DNA
EUR 154

Rab38 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7358404 1.0 ug DNA
EUR 154

Rab38 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4062502 1.0 ug DNA
EUR 154

Rab38 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4062503 1.0 ug DNA
EUR 154

Rab38 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4062504 1.0 ug DNA
EUR 154

RAB38 sgRNA CRISPR Lentivector (Human) (Target 1)

K1774102 1.0 ug DNA
EUR 154

RAB38 sgRNA CRISPR Lentivector (Human) (Target 2)

K1774103 1.0 ug DNA
EUR 154

RAB38 sgRNA CRISPR Lentivector (Human) (Target 3)

K1774104 1.0 ug DNA
EUR 154

RAB38 Protein Vector (Rat) (pPB-C-His)

PV297774 500 ng
EUR 603

RAB38 Protein Vector (Rat) (pPB-N-His)

PV297775 500 ng
EUR 603

RAB38 Protein Vector (Rat) (pPM-C-HA)

PV297776 500 ng
EUR 603

RAB38 Protein Vector (Rat) (pPM-C-His)

PV297777 500 ng
EUR 603

RAB38 Protein Vector (Human) (pPB-C-His)

PV033989 500 ng
EUR 329

RAB38 Protein Vector (Human) (pPB-N-His)

PV033990 500 ng
EUR 329

RAB38 Protein Vector (Human) (pPM-C-HA)

PV033991 500 ng
EUR 329

RAB38 Protein Vector (Human) (pPM-C-His)

PV033992 500 ng
EUR 329

RAB38 Protein Vector (Mouse) (pPB-C-His)

PV221726 500 ng
EUR 603

RAB38 Protein Vector (Mouse) (pPB-N-His)

PV221727 500 ng
EUR 603

RAB38 Protein Vector (Mouse) (pPM-C-HA)

PV221728 500 ng
EUR 603

RAB38 Protein Vector (Mouse) (pPM-C-His)

PV221729 500 ng
EUR 603

Rab38 3'UTR Luciferase Stable Cell Line

TU117418 1.0 ml Ask for price