SLC25A4 antibody
70R-6504 50 ug
EUR 467
Description: Rabbit polyclonal SLC25A4 antibody
SLC25A4 Antibody
ABD6674 100 ug
EUR 438
SLC25A4 Antibody
32484-100ul 100ul
EUR 252
SLC25A4 antibody
70R-20331 50 ul
EUR 435
Description: Rabbit polyclonal SLC25A4 antibody
SLC25A4 Antibody
DF6674 200ul
EUR 304
Description: SLC25A4 Antibody detects endogenous levels of total SLC25A4.
SLC25A4 siRNA
20-abx933760
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A4 siRNA
20-abx933761
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A4 Antibody
1-CSB-PA898234
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A4. Recognizes SLC25A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
SLC25A4 Antibody
1-CSB-PA021510GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLC25A4. Recognizes SLC25A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SLC25A4 Antibody
1-CSB-PA021510LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A4. Recognizes SLC25A4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
SLC25A4 Conjugated Antibody
C32484 100ul
EUR 397
SLC25A4 cloning plasmid
CSB-CL021510HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgggtgatcacgcttggagcttcctaaaggacttcctggccgggggcgtcgccgctgccgtctccaagaccgcggtcgcccccatcgagagggtcaaactgctgctgcaggtccagcatgccagcaaacagatcagtgctgagaagcagtacaaagggatcattgattgtgtggt
  • Show more
Description: A cloning plasmid for the SLC25A4 gene.
anti- SLC25A4 antibody
FNab07942 100µg
EUR 548.75
  • Immunogen: solute carrier family 25(mitochondrial carrier
  • adenine nucleotide translocator), member 4
  • Uniprot ID: P12235
  • Gene ID: 291
  • Research Area: Signal Transduction
Description: Antibody raised against SLC25A4
SLC25A4 Polyclonal Antibody
A60962 100 µg
EUR 570.55
Description: The best epigenetics products
SLC25A4 Rabbit pAb
A1882-100ul 100 ul
EUR 308
SLC25A4 Rabbit pAb
A1882-200ul 200 ul
EUR 459
SLC25A4 Rabbit pAb
A1882-20ul 20 ul
EUR 183
SLC25A4 Rabbit pAb
A1882-50ul 50 ul
EUR 223
SLC25A4 Rabbit pAb
A15027-100ul 100 ul
EUR 308
SLC25A4 Rabbit pAb
A15027-200ul 200 ul
EUR 459
SLC25A4 Rabbit pAb
A15027-20ul 20 ul
EUR 183
SLC25A4 Rabbit pAb
A15027-50ul 50 ul
EUR 223
SLC25A4 Blocking Peptide
33R-5186 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A4 antibody, catalog no. 70R-6504
SLC25A4 Blocking Peptide
DF6674-BP 1mg
EUR 195
Anti-SLC25A4 antibody
PAab07942 100 ug
EUR 386
pCMV-SPORT6-SLC25A4
PVT12946 2 ug
EUR 391
Anti-SLC25A4 antibody
STJ25571 100 µl
EUR 277
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy.
Anti-SLC25A4 antibody
STJ117221 100 µl
EUR 277
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy.
Rat SLC25A4 shRNA Plasmid
20-abx987017
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SLC25A4 ELISA Kit
ELA-E15023h 96 Tests
EUR 824
SLC25A4 ELISA KIT|Human
EF005863 96 Tests
EUR 689
Human SLC25A4 shRNA Plasmid
20-abx950203
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SLC25A4 shRNA Plasmid
20-abx969144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC25A4 Antibody, HRP conjugated
1-CSB-PA021510LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A4. Recognizes SLC25A4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC25A4 Antibody, FITC conjugated
1-CSB-PA021510LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A4. Recognizes SLC25A4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC25A4 Antibody, Biotin conjugated
1-CSB-PA021510LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A4. Recognizes SLC25A4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SLC25A4 Recombinant Protein (Human)
RP028888 100 ug Ask for price
SLC25A4 Recombinant Protein (Rat)
RP229253 100 ug Ask for price
SLC25A4 Recombinant Protein (Mouse)
RP172697 100 ug Ask for price
SLC25A4 Polyclonal Antibody, Biotin Conjugated
A60963 100 µg
EUR 570.55
Description: kits suitable for this type of research
SLC25A4 Polyclonal Antibody, FITC Conjugated
A60964 100 µg
EUR 570.55
Description: fast delivery possible
SLC25A4 Polyclonal Antibody, HRP Conjugated
A60965 100 µg
EUR 570.55
Description: reagents widely cited
SLC25A4 ORF Vector (Human) (pORF)
ORF009630 1.0 ug DNA
EUR 95
Slc25a4 ORF Vector (Mouse) (pORF)
ORF057567 1.0 ug DNA
EUR 506
Slc25a4 ORF Vector (Rat) (pORF)
ORF076419 1.0 ug DNA
EUR 506
SLC25A4 ELISA Kit (Human) (OKEH02443)
OKEH02443 96 Wells
EUR 779
Description: Description of target: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL
SLC25A4 ELISA Kit (Rat) (OKEH04195)
OKEH04195 96 Wells
EUR 662
Description: Description of target: catalyzes the exchange of ADP and ATP across the mitochondrial inner membrane [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL
SLC25A4 ELISA Kit (Rat) (OKCA01832)
OKCA01832 96 Wells
EUR 846
Description: Description of target: Catalyzes the exchange of cytoplasmic ADP with mitochondrial ATP across the mitochondrial inner membrane.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.7 pg/mL
SLC25A4 ELISA Kit (Bovine) (OKEH08104)
OKEH08104 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
ADP/ATP Translocase 1 (SLC25A4) Antibody
20-abx115670
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP/ATP Translocase 1 (SLC25A4) Antibody
20-abx001546
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP/ATP Translocase 1 (SLC25A4) Antibody
20-abx318363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADP/ATP Translocase 1 (SLC25A4) Antibody
abx411051-1ml 1 ml
EUR 439
  • Shipped within 1 week.
ADP/ATP Translocase 1 (SLC25A4) Antibody
abx237942-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
ADP/ATP translocase 1 (SLC25A4) Antibody
20-abx242235
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SLC25A4 sgRNA CRISPR Lentivector set (Human)
K2175801 3 x 1.0 ug
EUR 339
Slc25a4 sgRNA CRISPR Lentivector set (Mouse)
K3649101 3 x 1.0 ug
EUR 339
Slc25a4 sgRNA CRISPR Lentivector set (Rat)
K6988501 3 x 1.0 ug
EUR 339
ADP/ATP Translocase 1 (SLC25A4) Antibody (HRP)
20-abx305334
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADP/ATP Translocase 1 (SLC25A4) Antibody (FITC)
20-abx305335
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADP/ATP Translocase 1 (SLC25A4) Antibody (Biotin)
20-abx305336
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2175802 1.0 ug DNA
EUR 154
SLC25A4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2175803 1.0 ug DNA
EUR 154
SLC25A4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2175804 1.0 ug DNA
EUR 154
Slc25a4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3649102 1.0 ug DNA
EUR 154
Slc25a4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3649103 1.0 ug DNA
EUR 154
Slc25a4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3649104 1.0 ug DNA
EUR 154
Slc25a4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6988502 1.0 ug DNA
EUR 154
Slc25a4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6988503 1.0 ug DNA
EUR 154
Slc25a4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6988504 1.0 ug DNA
EUR 154
SLC25A4 Protein Vector (Human) (pPB-C-His)
PV038517 500 ng
EUR 329
SLC25A4 Protein Vector (Human) (pPB-N-His)
PV038518 500 ng
EUR 329
SLC25A4 Protein Vector (Human) (pPM-C-HA)
PV038519 500 ng
EUR 329
SLC25A4 Protein Vector (Human) (pPM-C-His)
PV038520 500 ng
EUR 329
SLC25A4 Protein Vector (Rat) (pPB-C-His)
PV305674 500 ng
EUR 603
SLC25A4 Protein Vector (Rat) (pPB-N-His)
PV305675 500 ng
EUR 603
SLC25A4 Protein Vector (Rat) (pPM-C-HA)
PV305676 500 ng
EUR 603
SLC25A4 Protein Vector (Rat) (pPM-C-His)
PV305677 500 ng
EUR 603
SLC25A4 Protein Vector (Mouse) (pPB-C-His)
PV230266 500 ng
EUR 603
SLC25A4 Protein Vector (Mouse) (pPB-N-His)
PV230267 500 ng
EUR 603
SLC25A4 Protein Vector (Mouse) (pPM-C-HA)
PV230268 500 ng
EUR 603
SLC25A4 Protein Vector (Mouse) (pPM-C-His)
PV230269 500 ng
EUR 603
Slc25a4 3'UTR GFP Stable Cell Line
TU169019 1.0 ml Ask for price
SLC25A4 3'UTR Luciferase Stable Cell Line
TU023473 1.0 ml
EUR 1394
Slc25a4 3'UTR Luciferase Stable Cell Line
TU119019 1.0 ml Ask for price