RPL27

RPL27 Antibody
1-CSB-PA02345A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

RPL27 Antibody
1-CSB-PA020213GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL27 antibody
70R-2387	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal RPL27 antibody raised against the middle region of RPL27

RPL27 antibody
70R-19975	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal RPL27 antibody

RPL27 siRNA
20-abx904658	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL27 siRNA
20-abx931948	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL27 siRNA
20-abx931949	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL27 Antibody
DF9129	Affbiotech	200ul	EUR 304.00
Description: RPL27 Antibody detects endogenous levels of total RPL27.

RPL27 Antibody
ABD9129	Lifescience Market	100 ug	EUR 438.00

RPL27 antibody
70R-15200	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPL27 antibody

RPL27 Antibody
45730-100ul	SAB	100ul	EUR 252.00

RPL27 Antibody
45730-50ul	SAB	50ul	EUR 187.00

pOTB7-RPL27
PVT18575	Lifescience Market	2 ug	EUR 231.00

RPL27 Conjugated Antibody
C45730	SAB	100ul	EUR 397.00

RPL27 cloning plasmid
CSB-CL020213HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 411 Sequence: atgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaa Show more
Description: A cloning plasmid for the RPL27 gene.

RPL27 cloning plasmid
CSB-CL020213HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 423 Sequence: atgatcaaaacaaagcatctaaaaccgcagtttctggaagaaccacttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagc Show more
Description: A cloning plasmid for the RPL27 gene.

RPL27 Blocking Peptide
33R-8904	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL27 antibody, catalog no. 70R-2387

RPL27 Polyclonal Antibody
A52708	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RPL27 Rabbit pAb
A5936-100ul	Abclonal	100 ul	EUR 308.00

RPL27 Rabbit pAb
A5936-200ul	Abclonal	200 ul	EUR 459.00

RPL27 Rabbit pAb
A5936-20ul	Abclonal	20 ul	Ask for price

RPL27 Rabbit pAb
A5936-50ul	Abclonal	50 ul	Ask for price

RPL27 antibody (HRP)
60R-1439	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPL27 antibody (HRP)

RPL27 antibody (FITC)
60R-1440	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPL27 antibody (FITC)

RPL27 antibody (biotin)
60R-1441	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPL27 antibody (biotin)

RPL27 Blocking Peptide
DF9129-BP	Affbiotech	1mg	EUR 195.00

RPL27 Rabbit pAb
A13044-100ul	Abclonal	100 ul	EUR 308.00

RPL27 Rabbit pAb
A13044-20ul	Abclonal	20 ul	EUR 183.00

RPL27 Rabbit pAb
A13044-50ul	Abclonal	50 ul	EUR 223.00

RPL27 Rabbit pAb
A13044-200ul	Abclonal	200 ul	EUR 459.00

anti- RPL27 antibody
FNab07426	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L27 Uniprot ID: P61353 Gene ID: 6155 Research Area: Metabolism
Description: Antibody raised against RPL27

Anti-RPL27 antibody
PAab07426	Lifescience Market	100 ug	EUR 386.00

Anti-RPL27 antibody
STJ115011	St John's Laboratory	100 µl	EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL27 antibody
STJ27732	St John's Laboratory	100 µl	EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Rat RPL27 shRNA Plasmid
20-abx986199	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL27 Antibody, HRP conjugated
1-CSB-PA02345B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL27 Antibody, FITC conjugated
1-CSB-PA02345C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL27 Antibody, Biotin conjugated
1-CSB-PA02345D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPL27 shRNA Plasmid
20-abx954140	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RPL27 shRNA Plasmid
20-abx972493	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine RPL27 ELISA KIT
ELI-42598d	Lifescience Market	96 Tests	EUR 928.00

RPL27 ELISA KIT|Human
EF002583	Lifescience Market	96 Tests	EUR 689.00

RPL27 Recombinant Protein (Human)
RP026929	ABM	100 ug	Ask for price

RPL27 Recombinant Protein (Human)
RP026932	ABM	100 ug	Ask for price

RPL27 Recombinant Protein (Mouse)
RP169013	ABM	100 ug	Ask for price

RPL27 Recombinant Protein (Rat)
RP226649	ABM	100 ug	Ask for price

Ribosomal Protein L27 (RPL27) Antibody
abx122993-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody
20-abx115236	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RPL27 Polyclonal Antibody, Biotin Conjugated
A52705	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RPL27 Polyclonal Antibody, FITC Conjugated
A52706	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RPL27 Polyclonal Antibody, HRP Conjugated
A52707	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Ribosomal Protein L27 (RPL27) Antibody
20-abx004552	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody
20-abx218355	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody
abx237426-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

RPL27 ORF Vector (Human) (pORF)
ORF008977	ABM	1.0 ug DNA	EUR 95.00

RPL27 ORF Vector (Human) (pORF)
ORF008978	ABM	1.0 ug DNA	EUR 95.00

Rpl27 ORF Vector (Mouse) (pORF)
ORF056339	ABM	1.0 ug DNA	EUR 506.00

Rpl27 ORF Vector (Rat) (pORF)
ORF075551	ABM	1.0 ug DNA	EUR 506.00

Ribosomal Protein L27 (RPL27) Antibody Pair
abx117454-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010.00
Shipped within 5-10 working days.

60S Ribosomal Protein L27 (RPL27) Antibody
20-abx109469	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL27 sgRNA CRISPR Lentivector set (Human)
K1952401	ABM	3 x 1.0 ug	EUR 339.00

Rpl27 sgRNA CRISPR Lentivector set (Rat)
K6935401	ABM	3 x 1.0 ug	EUR 339.00

Rpl27 sgRNA CRISPR Lentivector set (Mouse)
K4890901	ABM	3 x 1.0 ug	EUR 339.00

Human Ribosomal Protein L27 (RPL27) ELISA Kit
abx382911-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

RPL27 sgRNA CRISPR Lentivector (Human) (Target 1)
K1952402	ABM	1.0 ug DNA	EUR 154.00

RPL27 sgRNA CRISPR Lentivector (Human) (Target 2)
K1952403	ABM	1.0 ug DNA	EUR 154.00

RPL27 sgRNA CRISPR Lentivector (Human) (Target 3)
K1952404	ABM	1.0 ug DNA	EUR 154.00

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6935402	ABM	1.0 ug DNA	EUR 154.00

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6935403	ABM	1.0 ug DNA	EUR 154.00

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6935404	ABM	1.0 ug DNA	EUR 154.00

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4890902	ABM	1.0 ug DNA	EUR 154.00

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4890903	ABM	1.0 ug DNA	EUR 154.00

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4890904	ABM	1.0 ug DNA	EUR 154.00

RPL27 Protein Vector (Rat) (pPB-C-His)
PV302202	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Rat) (pPB-N-His)
PV302203	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Rat) (pPM-C-HA)
PV302204	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Rat) (pPM-C-His)
PV302205	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Mouse) (pPB-C-His)
PV225354	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Mouse) (pPB-N-His)
PV225355	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Mouse) (pPM-C-HA)
PV225356	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Mouse) (pPM-C-His)
PV225357	ABM	500 ng	EUR 603.00

RPL27 Protein Vector (Human) (pPB-C-His)
PV035905	ABM	500 ng	EUR 329.00

RPL27 Protein Vector (Human) (pPB-N-His)
PV035906	ABM	500 ng	EUR 329.00

RPL27 Protein Vector (Human) (pPM-C-HA)
PV035907	ABM	500 ng	EUR 329.00

RPL27 Protein Vector (Human) (pPM-C-His)
PV035908	ABM	500 ng	EUR 329.00