PSMC5

PSMC5 Antibody
1-CSB-PA018895LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:500

PSMC5 Antibody
CSB-PA018895KA01HU-	Cusabio		EUR 335.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PSMC5 Antibody
CSB-PA018895KA01HU-100ul	Cusabio	100ul	EUR 389.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PSMC5 antibody
20R-1193	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal PSMC5 antibody

PSMC5 antibody
10R-1411	Fitzgerald	100 ug	EUR 512.00
Description: Mouse monoclonal PSMC5 antibody

PSMC5 Antibody
32302-100ul	SAB	100ul	EUR 252.00

PSMC5 siRNA
20-abx904323	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMC5 siRNA
20-abx930170	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMC5 siRNA
20-abx930171	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMC5 Antibody
DF6445	Affbiotech	200ul	EUR 304.00
Description: PSMC5 Antibody detects endogenous levels of total PSMC5.

PSMC5 Antibody
ABD6445	Lifescience Market	100 ug	EUR 438.00

pOTB7-PSMC5
PVT18144	Lifescience Market	2 ug	EUR 231.00

PSMC5 Conjugated Antibody
C32302	SAB	100ul	EUR 397.00

PSMC5 cloning plasmid
CSB-CL018895HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1221 Sequence: atggcgcttgacggaccagagcagatggagctggaggaggggaaggcaggcagcggactccgccaatattatctgtccaagattgaagaactccagctgattgtgaatgataagagccaaaacctccggaggctgcaggcacagaggaacgaactaaatgctaaagttcgcctat Show more
Description: A cloning plasmid for the PSMC5 gene.

PSMC5 Blocking Peptide
33R-1153	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOSC2 antibody, catalog no. 70R-4705

PSMC5 Antibody (HRP)
20-abx317156	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PSMC5 Antibody (FITC)
20-abx317157	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PSMC5 Antibody (Biotin)
20-abx317158	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PSMC5 Blocking Peptide
DF6445-BP	Affbiotech	1mg	EUR 195.00

PSMC5 Rabbit pAb
A13537-100ul	Abclonal	100 ul	EUR 308.00

PSMC5 Rabbit pAb
A13537-200ul	Abclonal	200 ul	EUR 459.00

PSMC5 Rabbit pAb
A13537-20ul	Abclonal	20 ul	EUR 183.00

PSMC5 Rabbit pAb
A13537-50ul	Abclonal	50 ul	EUR 223.00

PSMC5 Rabbit pAb
A1538-100ul	Abclonal	100 ul	EUR 308.00

PSMC5 Rabbit pAb
A1538-200ul	Abclonal	200 ul	EUR 459.00

PSMC5 Rabbit pAb
A1538-20ul	Abclonal	20 ul	EUR 183.00

PSMC5 Rabbit pAb
A1538-50ul	Abclonal	50 ul	EUR 223.00

Anti-PSMC5 antibody
STJ115498	St John's Laboratory	100 µl	EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene.

Anti-PSMC5 antibody
STJ25184	St John's Laboratory	100 µl	EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene.

Rat PSMC5 shRNA Plasmid
20-abx986742	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSMC5 Antibody, FITC conjugated
1-CSB-PA018895LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC5 Antibody, Biotin conjugated
1-CSB-PA018895LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMC5 Antibody, HRP conjugated
1-CSB-PA018895LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Human PSMC5 shRNA Plasmid
20-abx953851	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PSMC5 shRNA Plasmid
20-abx972248	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSMC5 Recombinant Protein (Human)
RP024967	ABM	100 ug	Ask for price

PSMC5 Recombinant Protein (Mouse)
RP165308	ABM	100 ug	Ask for price

PSMC5 Recombinant Protein (Rat)
RP222650	ABM	100 ug	Ask for price

PSMC5 ORF Vector (Human) (pORF)
ORF008323	ABM	1.0 ug DNA	EUR 95.00

Psmc5 ORF Vector (Mouse) (pORF)
ORF055104	ABM	1.0 ug DNA	EUR 506.00

Psmc5 ORF Vector (Rat) (pORF)
ORF074218	ABM	1.0 ug DNA	EUR 506.00

Polyclonal PSMC5 antibody - C-terminal region
APR00730G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC5 - C-terminal region. This antibody is tested and proven to work in the following applications:

PSMC5 sgRNA CRISPR Lentivector set (Human)
K1741401	ABM	3 x 1.0 ug	EUR 339.00

Psmc5 sgRNA CRISPR Lentivector set (Rat)
K7056601	ABM	3 x 1.0 ug	EUR 339.00

Psmc5 sgRNA CRISPR Lentivector set (Mouse)
K4647401	ABM	3 x 1.0 ug	EUR 339.00

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody
abx117106-100ug	Abbexa	100 ug	EUR 467.00
Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody
abx122053-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody
20-abx001295	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody
20-abx141612	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody
20-abx302522	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PSMC5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1741402	ABM	1.0 ug DNA	EUR 154.00

PSMC5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1741403	ABM	1.0 ug DNA	EUR 154.00

PSMC5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1741404	ABM	1.0 ug DNA	EUR 154.00

Psmc5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7056602	ABM	1.0 ug DNA	EUR 154.00

Psmc5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7056603	ABM	1.0 ug DNA	EUR 154.00