  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK2 antibody

70R-32732 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody

RIPK2, Active

EUR 370

RIPK2 Antibody

ABD2641 100 ug
EUR 438

RIPK2 Antibody

ABD6967 100 ug
EUR 438

RIPK2 protein

30R-2861 5 ug
EUR 503
Description: Purified recombinant Human RIPK2 protein

RIPK2 Antibody

32675-100ul 100ul
EUR 252

RIPK2 antibody

70R-19904 50 ul
EUR 435
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 antibody

70R-10459 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

DF6967 200ul
EUR 304
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

DF2641 200ul
EUR 304
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

RIPK2 Conjugated Antibody

C32675 100ul
EUR 397

RIPK2 Blocking Peptide

AF7618-BP 1mg
EUR 195

RIPK2 cloning plasmid

CSB-CL019736HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

anti- RIPK2 antibody

FNab07314 100µg
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

RIPK2 (pS176) Antibody

abx011477-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody

abx011478-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 Polyclonal Antibody

A54388 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK2 antibody (Ser176)

70R-32731 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

RIPK2 Rabbit pAb

A13381-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb

A13381-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb

A13381-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb

A13381-50ul 50 ul
EUR 223

RIPK2 Rabbit pAb

A2498-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb

A2498-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb

A2498-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb

A2498-50ul 50 ul
EUR 223

RIPK2 Blocking Peptide

33R-5381 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459

RIPK2 Blocking Peptide

DF6967-BP 1mg
EUR 195

RIPK2 Blocking Peptide

DF2641-BP 1mg
EUR 195

Anti-RIPK2 antibody

PAab07314 100 ug
EUR 386

Anti-RIPK2 Antibody

STJ502801 100 µg
EUR 476

Anti-RIPK2 antibody

STJ25358 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody

STJ115343 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.


abx595529-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Phospho-RIPK2(Ser176) Antibody

AF0049 200ul
EUR 304
Description: Phospho-RIPK2(Ser176) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Sersine 176.

Mouse RIPK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-RIPK2 (Ser531) Antibody

AF7118 200ul
EUR 376
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.


EHR0362 96Tests
EUR 521


ELA-E1786h 96 Tests
EUR 824


EGTR0362 96Tests
EUR 521

Bovine RIPK2 ELISA Kit

EBR0362 96Tests
EUR 521

Chicken RIPK2 ELISA Kit

ECKR0362 96Tests
EUR 521

Anserini RIPK2 ELISA Kit

EAR0362 96Tests
EUR 521

Canine RIPK2 ELISA Kit

ECR0362 96Tests
EUR 521


ELI-05786b 96 Tests
EUR 928


ELI-05787h 96 Tests
EUR 824

Mouse Ripk2 ELISA KIT

ELI-05788m 96 Tests
EUR 865


EF007144 96 Tests
EUR 689

Porcine RIPK2 ELISA Kit

EPR0362 96Tests
EUR 521


ERR0362 96Tests
EUR 521


ESR0362 96Tests
EUR 521

Rabbit RIPK2 ELISA Kit

ERTR0362 96Tests
EUR 521

Monkey RIPK2 ELISA Kit

EMKR0362 96Tests
EUR 521


EMR0362 96Tests
EUR 521

Phospho- RIPK2 (Ser176) Antibody

ABF0048 100 ug
EUR 438

Phospho- RIPK2 (Ser176) Antibody

ABF0049 100 ug
EUR 438

Human RIPK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-RIPK2 (Ser176) Antibody

EUR 479

RIPK2 (Phospho-Ser176) Antibody

12120-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser176) Antibody

12120-50ul 50ul
EUR 187

RIPK2 (Phospho-Ser531) Antibody

12981-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser531) Antibody

12981-50ul 50ul
EUR 187

RIPK2 (Phospho-Tyr381) Antibody

12982-100ul 100ul
EUR 252

RIPK2 (Phospho-Tyr381) Antibody

12982-50ul 50ul
EUR 187

Phospho-RIPK2 (Ser176) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (Ser176) Antibody

CSB-PA231579-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (S176) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP2/RIPK2 Antibody

PA1861 100ug/vial
EUR 294

Anti-RIPK2 Antibody (Biotin)

STJ502802 100 µg
EUR 586

Anti-RIPK2 Antibody (FITC)

STJ502803 100 µg
EUR 586

Polyclonal RIPK2 Antibody (C-term)

AMR09745G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RIPK2 Antibody (N-term)

AMR09748G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (N-term). This antibody is tested and proven to work in the following applications:

RIPK2 (Phospho-Tyr381) Conjugated Antibody

C12982 100ul
EUR 397

Phospho-RIPK2(Ser176) Blocking Peptide

AF0049-BP 1mg
EUR 195

Phospho-RIPK2 (Ser531) Blocking Peptide

AF7118-BP 1mg
EUR 195

Guinea Pig RIPK2 ELISA Kit

EGR0362 96Tests
EUR 521