RIPK2 siRNA
20-abx931564
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RIPK2 siRNA
20-abx931565
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RIPK2 antibody
70R-32732 100 ug
EUR 327.00
Description: Rabbit polyclonal RIPK2 antibody

RIPK2, Active
7747-5
EUR 370.00

RIPK2 Antibody
ABD2641 100 ug
EUR 438.00

RIPK2 Antibody
ABD6967 100 ug
EUR 438.00

RIPK2 protein
30R-2861 5 ug
EUR 503.00
Description: Purified recombinant Human RIPK2 protein

RIPK2 Antibody
32675-100ul 100ul
EUR 252.00

RIPK2 antibody
70R-19904 50 ul
EUR 435.00
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 antibody
70R-10459 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 Antibody
DF6967 200ul
EUR 304.00
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody
DF2641 200ul
EUR 304.00
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody
1-CSB-PA070143
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody
1-CSB-PA019736ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody
1-CSB-PA019736GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody
1-CSB-PA019736LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

RIPK2 Conjugated Antibody
C32675 100ul
EUR 397.00

RIPK2 Blocking Peptide
AF7618-BP 1mg
EUR 195.00

RIPK2 cloning plasmid
CSB-CL019736HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

anti- RIPK2 antibody
FNab07314 100µg
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

RIPK2 (pS176) Antibody
abx011477-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody
abx011478-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RIPK2 Polyclonal Antibody
A54388 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK2 antibody (Ser176)
70R-32731 100 ug
EUR 327.00
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

RIPK2 Rabbit pAb
A13381-100ul 100 ul
EUR 308.00

RIPK2 Rabbit pAb
A13381-200ul 200 ul
EUR 459.00

RIPK2 Rabbit pAb
A13381-20ul 20 ul
EUR 183.00

RIPK2 Rabbit pAb
A13381-50ul 50 ul
EUR 223.00

RIPK2 Rabbit pAb
A2498-100ul 100 ul
EUR 308.00

RIPK2 Rabbit pAb
A2498-200ul 200 ul
EUR 459.00

RIPK2 Rabbit pAb
A2498-20ul 20 ul
EUR 183.00

RIPK2 Rabbit pAb
A2498-50ul 50 ul
EUR 223.00

RIPK2 Blocking Peptide
33R-5381 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459

RIPK2 Blocking Peptide
DF6967-BP 1mg
EUR 195.00

RIPK2 Blocking Peptide
DF2641-BP 1mg
EUR 195.00

Anti-RIPK2 antibody
PAab07314 100 ug
EUR 386.00

Anti-RIPK2 Antibody
STJ502801 100 µg
EUR 476.00

Anti-RIPK2 antibody
STJ25358 100 µl
EUR 277.00
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody
STJ115343 100 µl
EUR 277.00
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

RIPK2 Cell ELISA Kit
abx595529-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

Phospho-RIPK2(Ser176) Antibody
AF0049 200ul
EUR 304.00
Description: Phospho-RIPK2(Ser176) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Sersine 176.

Mouse RIPK2 shRNA Plasmid
20-abx980440
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Phospho-RIPK2 (Ser531) Antibody
AF7118 200ul
EUR 376.00
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.

Human RIPK2 ELISA Kit
EHR0362 96Tests
EUR 521.00

Human RIPK2 ELISA Kit
ELA-E1786h 96 Tests
EUR 824.00

Goat RIPK2 ELISA Kit
EGTR0362 96Tests
EUR 521.00

Bovine RIPK2 ELISA Kit
EBR0362 96Tests
EUR 521.00

Chicken RIPK2 ELISA Kit
ECKR0362 96Tests
EUR 521.00

Anserini RIPK2 ELISA Kit
EAR0362 96Tests
EUR 521.00

Canine RIPK2 ELISA Kit
ECR0362 96Tests
EUR 521.00

Bovine RIPK2 ELISA KIT
ELI-05786b 96 Tests
EUR 928.00

Human RIPK2 ELISA KIT
ELI-05787h 96 Tests
EUR 824.00

Mouse Ripk2 ELISA KIT
ELI-05788m 96 Tests
EUR 865.00

RIPK2 ELISA KIT|Human
EF007144 96 Tests
EUR 689.00

Porcine RIPK2 ELISA Kit
EPR0362 96Tests
EUR 521.00

Rat RIPK2 ELISA Kit
ERR0362 96Tests
EUR 521.00

Sheep RIPK2 ELISA Kit
ESR0362 96Tests
EUR 521.00

Rabbit RIPK2 ELISA Kit
ERTR0362 96Tests
EUR 521.00

Monkey RIPK2 ELISA Kit
EMKR0362 96Tests
EUR 521.00

Mouse RIPK2 ELISA Kit
EMR0362 96Tests
EUR 521.00

Phospho- RIPK2 (Ser176) Antibody
ABF0048 100 ug
EUR 438.00

Phospho- RIPK2 (Ser176) Antibody
ABF0049 100 ug
EUR 438.00

Human RIPK2 shRNA Plasmid
20-abx955775
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Phospho-RIPK2 (Ser176) Antibody
A1724-100
EUR 479.00

RIPK2 (Phospho-Ser176) Antibody
12120-100ul 100ul
EUR 252.00

RIPK2 (Phospho-Ser176) Antibody
12120-50ul 50ul
EUR 187.00

RIPK2 (Phospho-Ser531) Antibody
12981-100ul 100ul
EUR 252.00

RIPK2 (Phospho-Ser531) Antibody
12981-50ul 50ul
EUR 187.00

RIPK2 (Phospho-Tyr381) Antibody
12982-100ul 100ul
EUR 252.00

RIPK2 (Phospho-Tyr381) Antibody
12982-50ul 50ul
EUR 187.00

Phospho-RIPK2 (Ser176) Antibody
CSB-PA231579-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (Ser176) Antibody
CSB-PA231579-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (S176) Antibody
1-CSB-PA070142
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody, HRP conjugated
1-CSB-PA019736LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated
1-CSB-PA019736LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated
1-CSB-PA019736LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP2/RIPK2 Antibody
PA1861 100ug/vial
EUR 294.00

Anti-RIPK2 Antibody (Biotin)
STJ502802 100 µg
EUR 586.00

Anti-RIPK2 Antibody (FITC)
STJ502803 100 µg
EUR 586.00

Polyclonal RIPK2 Antibody (C-term)
AMR09745G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RIPK2 Antibody (N-term)
AMR09748G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (N-term). This antibody is tested and proven to work in the following applications:

RIPK2 (Phospho-Tyr381) Conjugated Antibody
C12982 100ul
EUR 397.00

Phospho-RIPK2(Ser176) Blocking Peptide
AF0049-BP 1mg
EUR 195.00

Phospho-RIPK2 (Ser531) Blocking Peptide
AF7118-BP 1mg
EUR 195.00

Guinea Pig RIPK2 ELISA Kit
EGR0362 96Tests
EUR 521.00