  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK2 antibody

70R-32732 100 ug
EUR 327.00
Description: Rabbit polyclonal RIPK2 antibody

RIPK2, Active

EUR 370.00

RIPK2 antibody

70R-19904 50 ul
EUR 435.00
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 antibody

70R-10459 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

ABD2641 100 ug
EUR 438.00

RIPK2 Antibody

ABD6967 100 ug
EUR 438.00

RIPK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody

DF2641 200ul
EUR 304.00
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

DF6967 200ul
EUR 304.00
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 protein

30R-2861 5 ug
EUR 503.00
Description: Purified recombinant Human RIPK2 protein

RIPK2 Antibody

32675-100ul 100ul
EUR 252.00

RIPK2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

RIPK2 Antibody

AF7618 200ul
EUR 376.00
Description: RIPK2 Antibody detects endogenous levels of RIPK2.

RIPK2 Polyclonal Antibody

E-AB-34146-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threon
  • Show more
Description: Rabbit antibody against Human,Mouse RIPK2 for WB,IHC-p,ELISA applications.

RIPK2 Polyclonal Antibody

E-AB-34146-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threon
  • Show more
Description: Rabbit antibody against Human,Mouse RIPK2 for WB,IHC-p,ELISA applications.

RIPK2 Polyclonal Antibody

E-AB-34146-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threon
  • Show more
Description: Rabbit antibody against Human,Mouse RIPK2 for WB,IHC-p,ELISA applications.

RIPK2 antibody (Ser176)

70R-32731 100 ug
EUR 327.00
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

RIPK2 Polyclonal Antibody

A54388 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK2 Rabbit pAb

A2498-100ul 100 ul
EUR 308.00

RIPK2 Rabbit pAb

A2498-200ul 200 ul
EUR 459.00

RIPK2 Rabbit pAb

A2498-20ul 20 ul
EUR 183.00

RIPK2 Rabbit pAb

A2498-50ul 50 ul
EUR 223.00

RIPK2 Rabbit pAb

A13381-100ul 100 ul
EUR 308.00

RIPK2 Rabbit pAb

A13381-200ul 200 ul
EUR 459.00

RIPK2 Rabbit pAb

A13381-20ul 20 ul
EUR 183.00

RIPK2 Rabbit pAb

A13381-50ul 50 ul
EUR 223.00

RIPK2 Blocking Peptide

DF2641-BP 1mg
EUR 195.00

RIPK2 Blocking Peptide

DF6967-BP 1mg
EUR 195.00

RIPK2 Blocking Peptide

33R-5381 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459

RIPK2 (pS176) Antibody

abx011477-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody

abx011478-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RIPK2 cloning plasmid

CSB-CL019736HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

RIPK2 Blocking Peptide

AF7618-BP 1mg
EUR 195.00

RIPK2 Conjugated Antibody

C32675 100ul
EUR 397.00

Anti-RIPK2 antibody

PAab07314 100 ug
EUR 386.00

anti- RIPK2 antibody

FNab07314 100µg
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

Anti-RIPK2 antibody

STJ115343 100 µl
EUR 277.00
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody

STJ25358 100 µl
EUR 277.00
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 Antibody

STJ502801 100 µg
EUR 476.00


abx595529-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

Human RIPK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RIPK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho- RIPK2 (Ser176) Antibody

ABF0048 100 ug
EUR 438.00

Phospho- RIPK2 (Ser176) Antibody

ABF0049 100 ug
EUR 438.00

Phospho-RIPK2 (Ser176) Antibody

EUR 479.00

Phospho-RIPK2 (Ser176) Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (Ser176) Antibody

CSB-PA231579-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (S176) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 (Phospho-Ser531) Antibody

12981-100ul 100ul
EUR 252.00

RIPK2 (Phospho-Ser531) Antibody

12981-50ul 50ul
EUR 187.00

RIPK2 (Phospho-Tyr381) Antibody

12982-100ul 100ul
EUR 252.00

RIPK2 (Phospho-Tyr381) Antibody

12982-50ul 50ul
EUR 187.00

RIPK2 (Phospho-Ser176) Antibody

12120-100ul 100ul
EUR 252.00

RIPK2 (Phospho-Ser176) Antibody

12120-50ul 50ul
EUR 187.00

RIPK2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-RIPK2(Ser176) Antibody

AF0049 200ul
EUR 304.00
Description: Phospho-RIPK2(Ser176) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Sersine 176.

Phospho-RIPK2 (Ser531) Antibody

AF7118 200ul
EUR 376.00
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.


ESR0362 96Tests
EUR 521.00

Porcine RIPK2 ELISA Kit

EPR0362 96Tests
EUR 521.00

Monkey RIPK2 ELISA Kit

EMKR0362 96Tests
EUR 521.00


EMR0362 96Tests
EUR 521.00


ERR0362 96Tests
EUR 521.00

Rabbit RIPK2 ELISA Kit

ERTR0362 96Tests
EUR 521.00

Anti-RIP2/RIPK2 Antibody

PA1861 100ug/vial
EUR 294.00


EHR0362 96Tests
EUR 521.00


EGTR0362 96Tests
EUR 521.00


ELA-E1786h 96 Tests
EUR 824.00


ELI-05786b 96 Tests
EUR 928.00


ELI-05787h 96 Tests
EUR 824.00

Mouse Ripk2 ELISA KIT

ELI-05788m 96 Tests
EUR 865.00

Anserini RIPK2 ELISA Kit

EAR0362 96Tests
EUR 521.00

Bovine RIPK2 ELISA Kit

EBR0362 96Tests
EUR 521.00

Chicken RIPK2 ELISA Kit

ECKR0362 96Tests
EUR 521.00


EF007144 96 Tests
EUR 689.00

Canine RIPK2 ELISA Kit

ECR0362 96Tests
EUR 521.00

Anti-RIPK2 Antibody (Biotin)

STJ502802 100 µg
EUR 586.00

Anti-RIPK2 Antibody (FITC)

STJ502803 100 µg
EUR 586.00

RIPK2 Polyclonal Antibody, Biotin Conjugated

A54385 100 µg
EUR 570.55
Description: The best epigenetics products

RIPK2 Polyclonal Antibody, FITC Conjugated

A54386 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK2 Polyclonal Antibody, HRP Conjugated

A54387 100 µg
EUR 570.55
Description: fast delivery possible