RIPK2 antibody
70R-10459	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 antibody
70R-19904	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 Antibody
32675-100ul	SAB	100ul	EUR 252

RIPK2 Antibody
1-CSB-PA070143	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody
DF2641	Affbiotech	200ul	EUR 304
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody
DF6967	Affbiotech	200ul	EUR 304
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2, Active
7747-5	Biovision		EUR 370

RIPK2 antibody
70R-32732	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 Antibody
1-CSB-PA019736ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody
1-CSB-PA019736GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody
1-CSB-PA019736LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

RIPK2 siRNA
20-abx931564	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RIPK2 siRNA
20-abx931565	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RIPK2 Antibody
AF7618	Affbiotech	200ul	EUR 376
Description: RIPK2 Antibody detects endogenous levels of RIPK2.

RIPK2 Antibody
ABD2641	Lifescience Market	100 ug	EUR 438

RIPK2 Antibody
ABD6967	Lifescience Market	100 ug	EUR 438

RIPK2 Rabbit pAb
A13381-100ul	Abclonal	100 ul	EUR 308

RIPK2 Rabbit pAb
A13381-200ul	Abclonal	200 ul	EUR 459

RIPK2 Rabbit pAb
A13381-20ul	Abclonal	20 ul	EUR 183

RIPK2 Rabbit pAb
A13381-50ul	Abclonal	50 ul	EUR 223

RIPK2 Blocking Peptide
33R-5381	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459

RIPK2 Blocking Peptide
DF2641-BP	Affbiotech	1mg	EUR 195

RIPK2 Blocking Peptide
DF6967-BP	Affbiotech	1mg	EUR 195

RIPK2 antibody (Ser176)
70R-32731	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

RIPK2 (pS176) Antibody
abx011477-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RIPK2 (pS176) Antibody
abx011478-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RIPK2 Conjugated Antibody
C32675	SAB	100ul	EUR 397

RIPK2 cloning plasmid
CSB-CL019736HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1623 Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg Show more
Description: A cloning plasmid for the RIPK2 gene.

RIPK2 Blocking Peptide
AF7618-BP	Affbiotech	1mg	EUR 195

RIPK2 Polyclonal Antibody
A54388	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RIPK2 Rabbit pAb
A2498-100ul	Abclonal	100 ul	EUR 308

RIPK2 Rabbit pAb
A2498-200ul	Abclonal	200 ul	EUR 459

RIPK2 Rabbit pAb
A2498-20ul	Abclonal	20 ul	EUR 183

RIPK2 Rabbit pAb
A2498-50ul	Abclonal	50 ul	EUR 223

anti- RIPK2 antibody
FNab07314	FN Test	100µg	EUR 548.75
Immunogen: receptor-interacting serine-threonine kinase 2 Uniprot ID: O43353 Gene ID: 8767 Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

Anti-RIPK2 antibody
PAab07314	Lifescience Market	100 ug	EUR 386

Anti-RIPK2 antibody
STJ25358	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody
STJ115343	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 Antibody
STJ502801	St John's Laboratory	100 µg	EUR 476

RIPK2 (Phospho-Ser176) Antibody
12120-100ul	SAB	100ul	EUR 252

RIPK2 (Phospho-Ser176) Antibody
12120-50ul	SAB	50ul	EUR 187

RIPK2 (Phospho-Ser531) Antibody
12981-100ul	SAB	100ul	EUR 252

RIPK2 (Phospho-Ser531) Antibody
12981-50ul	SAB	50ul	EUR 187

RIPK2 (Phospho-Tyr381) Antibody
12982-100ul	SAB	100ul	EUR 252

RIPK2 (Phospho-Tyr381) Antibody
12982-50ul	SAB	50ul	EUR 187

Phospho-RIPK2 (S176) Antibody
1-CSB-PA070142	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Phospho-RIPK2 (Ser176) Antibody
CSB-PA231579-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (Ser176) Antibody
CSB-PA231579-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Human RIPK2 ELISA Kit
ELA-E1786h	Lifescience Market	96 Tests	EUR 824

Human RIPK2 ELISA Kit
EHR0362	Abclonal	96Tests	EUR 521

Bovine RIPK2 ELISA Kit
EBR0362	Abclonal	96Tests	EUR 521

Anserini RIPK2 ELISA Kit
EAR0362	Abclonal	96Tests	EUR 521

Chicken RIPK2 ELISA Kit
ECKR0362	Abclonal	96Tests	EUR 521

Canine RIPK2 ELISA Kit
ECR0362	Abclonal	96Tests	EUR 521

Goat RIPK2 ELISA Kit
EGTR0362	Abclonal	96Tests	EUR 521

Bovine RIPK2 ELISA KIT
ELI-05786b	Lifescience Market	96 Tests	EUR 928

Human RIPK2 ELISA KIT
ELI-05787h	Lifescience Market	96 Tests	EUR 824

Mouse Ripk2 ELISA KIT
ELI-05788m	Lifescience Market	96 Tests	EUR 865

RIPK2 ELISA KIT|Human
EF007144	Lifescience Market	96 Tests	EUR 689

Phospho-RIPK2(Ser176) Antibody
AF0049	Affbiotech	200ul	EUR 304
Description: Phospho-RIPK2(Ser176) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Sersine 176.

Phospho-RIPK2 (Ser531) Antibody
AF7118	Affbiotech	200ul	EUR 376
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.

RIPK2 Antibody, HRP conjugated
1-CSB-PA019736LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated
1-CSB-PA019736LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated
1-CSB-PA019736LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RIPK2 Cell ELISA Kit
abx595529-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human RIPK2 shRNA Plasmid
20-abx955775	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RIPK2 shRNA Plasmid
20-abx980440	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho- RIPK2 (Ser176) Antibody
ABF0048	Lifescience Market	100 ug	EUR 438

Phospho- RIPK2 (Ser176) Antibody
ABF0049	Lifescience Market	100 ug	EUR 438

Phospho-RIPK2 (Ser176) Antibody
A1724-100	Biovision		EUR 479

Porcine RIPK2 ELISA Kit
EPR0362	Abclonal	96Tests	EUR 521

Sheep RIPK2 ELISA Kit
ESR0362	Abclonal	96Tests	EUR 521

Rat RIPK2 ELISA Kit
ERR0362	Abclonal	96Tests	EUR 521

Rabbit RIPK2 ELISA Kit
ERTR0362	Abclonal	96Tests	EUR 521

Monkey RIPK2 ELISA Kit
EMKR0362	Abclonal	96Tests	EUR 521

Mouse RIPK2 ELISA Kit
EMR0362	Abclonal	96Tests	EUR 521

Anti-RIP2/RIPK2 Antibody
PA1861	BosterBio	100ug/vial	EUR 294

Anti-RIPK2 Antibody (Biotin)
STJ502802	St John's Laboratory	100 µg	EUR 586

Anti-RIPK2 Antibody (FITC)
STJ502803	St John's Laboratory	100 µg	EUR 586

Polyclonal RIPK2 Antibody (C-term)
AMR09745G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RIPK2 Antibody (N-term)
AMR09748G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (N-term). This antibody is tested and proven to work in the following applications:

Guinea Pig RIPK2 ELISA Kit
EGR0362	Abclonal	96Tests	EUR 521

Phospho-RIPK2(Ser176) Blocking Peptide
AF0049-BP	Affbiotech	1mg	EUR 195

Phospho-RIPK2 (Ser531) Blocking Peptide
AF7118-BP	Affbiotech	1mg	EUR 195

RIPK2 (Phospho-Tyr381) Conjugated Antibody
C12982	SAB	100ul	EUR 397