Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-b-96T 96T
EUR 746
  • Should the Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-Hu-48T 48T
EUR 498
  • Should the Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-Hu-96T 96T
EUR 647
  • Should the Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-Mu-48T 48T
EUR 508
  • Should the Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-Mu-96T 96T
EUR 661
  • Should the Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-p-48T 48T
EUR 569
  • Should the Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-p-96T 96T
EUR 746
  • Should the Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-Ra-48T 48T
EUR 528
  • Should the Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit
DLR-LBP-Ra-96T 96T
EUR 690
  • Should the Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-b-48Tests 48 Tests
EUR 607

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-b-96Tests 96 Tests
EUR 845

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-Hu-48Tests 48 Tests
EUR 522

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-Hu-96Tests 96 Tests
EUR 724

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-Mu-48Tests 48 Tests
EUR 534

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-Mu-96Tests 96 Tests
EUR 742

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-p-48Tests 48 Tests
EUR 607

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-p-96Tests 96 Tests
EUR 845

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-Ra-48Tests 48 Tests
EUR 558

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RDR-LBP-Ra-96Tests 96 Tests
EUR 776

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-b-48Tests 48 Tests
EUR 580

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-b-96Tests 96 Tests
EUR 807

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-Hu-48Tests 48 Tests
EUR 500

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-Hu-96Tests 96 Tests
EUR 692

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-Mu-48Tests 48 Tests
EUR 511

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-Mu-96Tests 96 Tests
EUR 709

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-p-48Tests 48 Tests
EUR 580

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-p-96Tests 96 Tests
EUR 807

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-Ra-48Tests 48 Tests
EUR 534

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit
RD-LBP-Ra-96Tests 96 Tests
EUR 742

LBP/ Rat LBP ELISA Kit
ELA-E1406r 96 Tests
EUR 886

Lbp/ Rat Lbp ELISA Kit
ELI-04578r 96 Tests
EUR 886

LBP protein
30R-2780 10 ug
EUR 659
Description: Purified recombinant Human LBP protein

LBP protein
30R-2781 10 ug
EUR 659
Description: Purified recombinant mouse LBP protein

LBP antibody
22607-100ul 100ul
EUR 390

LBP antibody
70R-18225 50 ul
EUR 435
Description: Rabbit polyclonal LBP antibody

LBP antibody
70R-12879 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal LBP antibody

LBP Antibody
DF4840 200ul
EUR 304
Description: LBP Antibody detects endogenous levels of total LBP.

LBP antibody
70R-5906 50 ug
EUR 467
Description: Rabbit polyclonal LBP antibody raised against the C terminal of LBP

LBP antibody
70R-5907 50 ug
EUR 467
Description: Rabbit polyclonal LBP antibody raised against the middle region of LBP

LBP Antibody
1-CSB-PA012775GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

LBP Antibody
1-CSB-PA012775LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LBP Antibody
1-CSB-PA009787
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LBP. Recognizes LBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

LBP siRNA
20-abx922306
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LBP siRNA
20-abx922307
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LBP Antibody
ABD4840 100 ug
EUR 438

LBP Polyclonal Antibody
30057-100ul 100ul
EUR 252

LBP Polyclonal Antibody
30057-50ul 50ul
EUR 187

LBP Blocking Peptide
33R-2965 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LBP antibody, catalog no. 70R-5906

LBP Blocking Peptide
33R-5143 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LBP antibody, catalog no. 70R-5907

LBP, human recombinant
4935-10
EUR 501

LBP, mouse recombinant
4936-10
EUR 501

LBP Blocking Peptide
DF4840-BP 1mg
EUR 195

Anti-LBP Antibody
A00809-1 100ug/vial
EUR 294

Anti-LBP Antibody
A00809-2 100ug/vial
EUR 294

Anti-LBP Antibody
A00809-3 100ug/vial
EUR 294

LBP cloning plasmid
CSB-CL012775HU-10ug 10ug
EUR 511
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1434
  • Sequence: atgggggccttggccagagccctgccgtccatactgctggcattgctgcttacgtccaccccagaggctctgggtgccaaccccggcttggtcgccaggatcaccgacaagggactgcagtatgcggcccaggaggggctattggctctgcagagtgagctgctcaggatcacgc
  • Show more
Description: A cloning plasmid for the LBP gene.

LBP Polyclonal Antibody
ABP55092-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of LBP from Human, Mouse, Rat. This LBP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270

LBP Polyclonal Antibody
ABP55092-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of LBP from Human, Mouse, Rat. This LBP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270

LBP Polyclonal Antibody
ABP55092-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of LBP from Human, Mouse, Rat. This LBP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270

LBP Rabbit pAb
A8764-100ul 100 ul
EUR 384

LBP Rabbit pAb
A8764-200ul 200 ul Ask for price

LBP Rabbit pAb
A8764-20ul 20 ul Ask for price

LBP Rabbit pAb
A8764-50ul 50 ul
EUR 265

LBP Rabbit pAb
A17507-100ul 100 ul
EUR 308

LBP Rabbit pAb
A17507-200ul 200 ul
EUR 459

LBP Rabbit pAb
A17507-20ul 20 ul
EUR 183

LBP Rabbit pAb
A17507-50ul 50 ul
EUR 223

LBP Polyclonal Antibody
ES6091-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LBP Polyclonal Antibody
ES6091-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- LBP antibody
FNab04712 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: lipopolysaccharide binding protein
  • Uniprot ID: P18428
  • Gene ID: 3929
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against LBP

anti- LBP antibody
FNab04713 100µg
EUR 505.25
  • Immunogen: lipopolysaccharide binding protein
  • Uniprot ID: P18428
  • Gene ID: 3929
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against LBP

anti- LBP antibody
FNab04714 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: lipopolysaccharide binding protein
  • Uniprot ID: P18428
  • Gene ID: 3929
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against LBP

Anti-LBP antibody
PAab04712 100 ug
EUR 355

Anti-LBP antibody
PAab04713 100 ug
EUR 355

Anti-LBP antibody
STJ113584 100 µl
EUR 393
Description: The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP).

Anti-LBP antibody
STJ119599 100 µl
EUR 277
Description: The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]

Anti-LBP antibody
STJ93909 200 µl
EUR 197
Description: Rabbit polyclonal to LBP.

Anti-LBP (4E8)
YF-MA13961 200 ul
EUR 363
Description: Mouse monoclonal to LBP

Human LBP ELISA Kit
EHL0216 96Tests
EUR 521

Human LBP ELISA Kit
ELA-E1406h 96 Tests
EUR 824

Bovine LBP ELISA Kit
EBL0216 96Tests
EUR 521

CHICKEN LBP ELISA KIT
ECKL0216 96Tests
EUR 521

Anserini LBP ELISA Kit
EAL0216 96Tests
EUR 521

Canine LBP ELISA Kit
ECL0216 96Tests
EUR 521

Goat LBP ELISA Kit
EGTL0216 96Tests
EUR 521

LBP ELISA KIT|Human
EF005718 96 Tests
EUR 689

LBP Polyclonal Conjugated Antibody
C30057 100ul
EUR 397

LBP Antibody, HRP conjugated
1-CSB-PA012775LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LBP Antibody, FITC conjugated
1-CSB-PA012775LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LBP Antibody, Biotin conjugated
1-CSB-PA012775LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LBP shRNA Plasmid
20-abx952661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LBP shRNA Plasmid
20-abx971285
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine LBP ELISA Kit
EPL0216 96Tests
EUR 521

Sheep LBP ELISA Kit
ESL0216 96Tests
EUR 521

Rat LBP ELISA Kit
ERL0216 96Tests
EUR 521