Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-b-96T 96T
EUR 746.00
  • Should the Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-Hu-48T 48T
EUR 498.00
  • Should the Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-Hu-96T 96T
EUR 647.00
  • Should the Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-Mu-48T 48T
EUR 508.00
  • Should the Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-Mu-96T 96T
EUR 661.00
  • Should the Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-p-48T 48T
EUR 569.00
  • Should the Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-p-96T 96T
EUR 746.00
  • Should the Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-Ra-48T 48T
EUR 528.00
  • Should the Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit

DLR-LBP-Ra-96T 96T
EUR 690.00
  • Should the Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipopolysaccharide Binding Protein (LBP) in samples from serum, plasma or other biological fluids.

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-b-48Tests 48 Tests
EUR 580.00

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-b-96Tests 96 Tests
EUR 807.00

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-Hu-48Tests 48 Tests
EUR 500.00

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-Hu-96Tests 96 Tests
EUR 692.00

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-Mu-48Tests 48 Tests
EUR 511.00

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-Mu-96Tests 96 Tests
EUR 709.00

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-p-48Tests 48 Tests
EUR 580.00

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-p-96Tests 96 Tests
EUR 807.00

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-Ra-48Tests 48 Tests
EUR 534.00

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RD-LBP-Ra-96Tests 96 Tests
EUR 742.00

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-b-48Tests 48 Tests
EUR 607.00

Bovine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-b-96Tests 96 Tests
EUR 845.00

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-Hu-48Tests 48 Tests
EUR 522.00

Human Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-Hu-96Tests 96 Tests
EUR 724.00

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-Mu-48Tests 48 Tests
EUR 534.00

Mouse Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-Mu-96Tests 96 Tests
EUR 742.00

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-p-48Tests 48 Tests
EUR 607.00

Porcine Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-p-96Tests 96 Tests
EUR 845.00

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-Ra-48Tests 48 Tests
EUR 558.00

Rat Lipopolysaccharide Binding Protein (LBP) ELISA Kit

RDR-LBP-Ra-96Tests 96 Tests
EUR 776.00

LBP/ Rat LBP ELISA Kit

ELA-E1406r 96 Tests
EUR 886.00

Lbp/ Rat Lbp ELISA Kit

ELI-04578r 96 Tests
EUR 886.00

LBP siRNA

20-abx922306
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LBP siRNA

20-abx922307
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LBP antibody

70R-5906 50 ug
EUR 467.00
Description: Rabbit polyclonal LBP antibody raised against the C terminal of LBP

LBP antibody

70R-5907 50 ug
EUR 467.00
Description: Rabbit polyclonal LBP antibody raised against the middle region of LBP

LBP Antibody

ABD4840 100 ug
EUR 438.00

LBP protein

30R-2780 10 ug
EUR 659.00
Description: Purified recombinant Human LBP protein

LBP protein

30R-2781 10 ug
EUR 659.00
Description: Purified recombinant mouse LBP protein

LBP antibody

22607-100ul 100ul
EUR 390.00

LBP antibody

70R-18225 50 ul
EUR 435.00
Description: Rabbit polyclonal LBP antibody

LBP antibody

70R-12879 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal LBP antibody

LBP Antibody

DF4840 200ul
EUR 304.00
Description: LBP Antibody detects endogenous levels of total LBP.

LBP Antibody

1-CSB-PA012775GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

LBP Antibody

1-CSB-PA012775LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LBP. Recognizes LBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LBP Antibody

1-CSB-PA009787
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LBP. Recognizes LBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

LBP cloning plasmid

CSB-CL012775HU-10ug 10ug
EUR 511.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1434
  • Sequence: atgggggccttggccagagccctgccgtccatactgctggcattgctgcttacgtccaccccagaggctctgggtgccaaccccggcttggtcgccaggatcaccgacaagggactgcagtatgcggcccaggaggggctattggctctgcagagtgagctgctcaggatcacgc
  • Show more
Description: A cloning plasmid for the LBP gene.

anti- LBP antibody

FNab04712 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: lipopolysaccharide binding protein
  • Uniprot ID: P18428
  • Gene ID: 3929
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against LBP

anti- LBP antibody

FNab04713 100µg
EUR 505.25
  • Immunogen: lipopolysaccharide binding protein
  • Uniprot ID: P18428
  • Gene ID: 3929
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against LBP

anti- LBP antibody

FNab04714 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: lipopolysaccharide binding protein
  • Uniprot ID: P18428
  • Gene ID: 3929
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against LBP

LBP Polyclonal Antibody

ES6091-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against LBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LBP Polyclonal Antibody

ES6091-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against LBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LBP Polyclonal Antibody

ABP55092-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of LBP from Human, Mouse, Rat. This LBP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270

LBP Polyclonal Antibody

ABP55092-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of LBP from Human, Mouse, Rat. This LBP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270

LBP Polyclonal Antibody

ABP55092-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of LBP from Human, Mouse, Rat. This LBP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LBP at AA rangle: 190-270

Anti-LBP Antibody

A00809-1 100ug/vial
EUR 294.00

Anti-LBP Antibody

A00809-2 100ug/vial
EUR 294.00

Anti-LBP Antibody

A00809-3 100ug/vial
EUR 294.00

LBP Rabbit pAb

A17507-100ul 100 ul
EUR 308.00

LBP Rabbit pAb

A17507-200ul 200 ul
EUR 459.00

LBP Rabbit pAb

A17507-20ul 20 ul
EUR 183.00

LBP Rabbit pAb

A17507-50ul 50 ul
EUR 223.00

LBP Rabbit pAb

A8764-100ul 100 ul
EUR 384.00

LBP Rabbit pAb

A8764-200ul 200 ul Ask for price

LBP Rabbit pAb

A8764-20ul 20 ul Ask for price

LBP Rabbit pAb

A8764-50ul 50 ul
EUR 265.00

LBP Blocking Peptide

33R-5143 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LBP antibody, catalog no. 70R-5907

LBP Blocking Peptide

33R-2965 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LBP antibody, catalog no. 70R-5906

LBP, human recombinant

4935-10
EUR 501.00

LBP, mouse recombinant

4936-10
EUR 501.00

LBP Polyclonal Antibody

30057-100ul 100ul
EUR 252.00

LBP Polyclonal Antibody

30057-50ul 50ul
EUR 187.00

LBP Blocking Peptide

DF4840-BP 1mg
EUR 195.00

Anti-LBP antibody

PAab04712 100 ug
EUR 355.00

Anti-LBP antibody

PAab04713 100 ug
EUR 355.00

Anti-LBP antibody

STJ93909 200 µl
EUR 197.00
Description: Rabbit polyclonal to LBP.

Anti-LBP antibody

STJ113584 100 µl
EUR 393.00
Description: The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP).

Anti-LBP antibody

STJ119599 100 µl
EUR 277.00
Description: The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]

Anti-LBP (4E8)

YF-MA13961 200 ul
EUR 363.00
Description: Mouse monoclonal to LBP

LBP Polyclonal Conjugated Antibody

C30057 100ul
EUR 397.00

Human LBP ELISA Kit

EHL0216 96Tests
EUR 521.00

Human LBP ELISA Kit

ELA-E1406h 96 Tests
EUR 824.00

Goat LBP ELISA Kit

EGTL0216 96Tests
EUR 521.00

Bovine LBP ELISA Kit

EBL0216 96Tests
EUR 521.00

CHICKEN LBP ELISA KIT

ECKL0216 96Tests
EUR 521.00

Canine LBP ELISA Kit

ECL0216 96Tests
EUR 521.00

Anserini LBP ELISA Kit

EAL0216 96Tests
EUR 521.00

LBP ELISA KIT|Human

EF005718 96 Tests
EUR 689.00

Porcine LBP ELISA Kit

EPL0216 96Tests
EUR 521.00

Rat LBP ELISA Kit

ERL0216 96Tests
EUR 521.00

Rabbit LBP ELISA Kit

ERTL0216 96Tests
EUR 521.00

Sheep LBP ELISA Kit

ESL0216 96Tests
EUR 521.00

Monkey LBP ELISA Kit

EMKL0216 96Tests
EUR 521.00

Mouse LBP ELISA Kit

EML0216 96Tests
EUR 521.00

Mouse LBP shRNA Plasmid

20-abx971285
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human LBP shRNA Plasmid

20-abx952661
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.