Gemini Genomics

NGS Sequencing

PSCA

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
DL-PSCA-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Prostate Stem Cell Antigen (PSCA)

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
DL-PSCA-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Prostate Stem Cell Antigen (PSCA)

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
DL-PSCA-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Prostate Stem Cell Antigen (PSCA)

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
DLR-PSCA-Hu-96T 96T
EUR 673.00
  • Should the Human Prostate Stem Cell Antigen (PSCA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prostate Stem Cell Antigen (PSCA) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
RD-PSCA-Hu-48Tests 48 Tests
EUR 521.00

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
RD-PSCA-Hu-96Tests 96 Tests
EUR 723.00

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
RDR-PSCA-Hu-48Tests 48 Tests
EUR 544.00

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit
RDR-PSCA-Hu-96Tests 96 Tests
EUR 756.00

PSCA antibody
70R-50580 100 ul
EUR 244.00
Description: Purified Polyclonal PSCA antibody

PSCA antibody
70R-8532 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal PSCA antibody

PSCA antibody
70R-19568 50 ul
EUR 435.00
Description: Rabbit polyclonal PSCA antibody

PSCA antibody
70R-30729 100 ug
EUR 327.00
Description: Rabbit polyclonal PSCA antibody

PSCA Antibody
1-CSB-PA003863
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

PSCA Antibody
1-CSB-PA587709
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PSCA Antibody
1-CSB-PA058956
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

PSCA Antibody
32922-100ul 100ul
EUR 252.00

PSCA protein
30R-3214S 50 ug
EUR 259.00
Description: Purified recombinant PSCA protein

PSCA Antibody
1-CSB-PA018840ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PSCA Antibody
1-CSB-PA018840GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSCA Antibody
CSB-PA052817-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSCA Antibody
CSB-PA052817-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

anti-PSCA
YF-PA15514 50 ug
EUR 363.00
Description: Mouse polyclonal to PSCA

anti-PSCA
YF-PA15515 100 ug
EUR 403.00
Description: Rabbit polyclonal to PSCA

anti-PSCA
YF-PA25029 50 ul
EUR 334.00
Description: Mouse polyclonal to PSCA

Anti-PSCA Antibody
A02657 1ml
EUR 456.00
Description: Rabbit Polyclonal PSCA Antibody. Validated in IHC and tested in Human.

PSCA Rabbit pAb
A5614-100ul 100 ul
EUR 308.00

PSCA Rabbit pAb
A5614-200ul 200 ul
EUR 459.00

PSCA Rabbit pAb
A5614-20ul 20 ul
EUR 183.00

PSCA Rabbit pAb
A5614-50ul 50 ul
EUR 223.00

PSCA Polyclonal Antibody
ABP52269-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSCA from Human, Mouse. This PSCA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90

PSCA Polyclonal Antibody
ABP52269-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSCA from Human, Mouse. This PSCA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90

PSCA Polyclonal Antibody
ABP52269-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSCA from Human, Mouse. This PSCA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90

Anti-PSCA Antibody
A1611-100
EUR 370.00

PSCA Blocking Peptide
33R-9358 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSCA antibody, catalog no. 70R-8532

PSCA Polyclonal Antibody
41364-100ul 100ul
EUR 252.00

PSCA Polyclonal Antibody
41364-50ul 50ul
EUR 187.00

PSCA Blocking Peptide
20-abx063455
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PSCA Polyclonal Antibody
E-AB-32668-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: PSCA (Prostate Stem Cell antigen) is a cell surface antigen, which is overexpressed in ~40%
  • Show more
Description: Rabbit antibody against Human,Mouse PSCA for WB,ELISA applications.

PSCA Polyclonal Antibody
E-AB-32668-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: PSCA (Prostate Stem Cell antigen) is a cell surface antigen, which is overexpressed in ~40%
  • Show more
Description: Rabbit antibody against Human,Mouse PSCA for WB,ELISA applications.

PSCA Polyclonal Antibody
E-AB-32668-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: PSCA (Prostate Stem Cell antigen) is a cell surface antigen, which is overexpressed in ~40%
  • Show more
Description: Rabbit antibody against Human,Mouse PSCA for WB,ELISA applications.

PSCA cloning plasmid
CSB-CL018840HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atgaaggctgtgctgcttgccctgttgatggcaggcttggccctgcagccaggcactgccctgctgtgctactcctgcaaagcccaggtgagcaacgaggactgcctgcaggtggagaactgcacccagctgggggagcagtgctggaccgcgcgcatccgcgcagttggcctcct
  • Show more
Description: A cloning plasmid for the PSCA gene.

PSCA Conjugated Antibody
C32922 100ul
EUR 397.00

Anti-PSCA Antibody
PB9351 100ug/vial
EUR 294.00

Anti-PSCA antibody
PAab06848 100 ug
EUR 412.00

PSCA Polyclonal Antibody
ES3268-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against PSCA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSCA Polyclonal Antibody
ES3268-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against PSCA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- PSCA antibody
FNab06848 100µg
EUR 585.00
  • Immunogen: prostate stem cell antigen
  • Uniprot ID: O43653
  • Research Area: Stem Cells, Cancer
Description: Antibody raised against PSCA

Anti-PSCA antibody
STJ11100914 100 µl
EUR 277.00
Description: This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants.

pOTB7-PSCA Plasmid
PVT15918 2 ug
EUR 325.00

pOTB7-PSCA Plasmid
PVT15937 2 ug
EUR 325.00

Anti-PSCA antibody
STJ95242 200 µl
EUR 197.00
Description: Rabbit polyclonal to PSCA.

Anti-PSCA (5C2)
YF-MA11038 100 ug
EUR 363.00
Description: Mouse monoclonal to PSCA

Anti-PSCA (1E1)
YF-MA16262 100 ug
EUR 363.00
Description: Mouse monoclonal to PSCA

Polyclonal PSCA Antibody (Center)
AMM08670G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSCA (Center). This antibody is tested and proven to work in the following applications:

Human PSCA ELISA Kit
ELA-E8693h 96 Tests
EUR 824.00