RPS17 Antibody
45724-100ul	SAB	100ul	EUR 252

RPS17 Antibody
45724-50ul	SAB	50ul	EUR 187

RPS17 Antibody
DF9118	Affbiotech	200ul	EUR 304
Description: RPS17 Antibody detects endogenous levels of total RPS17.

RPS17 antibody
70R-51420	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal RPS17 antibody

RPS17 siRNA
20-abx904693	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS17 siRNA
20-abx932049	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS17 siRNA
20-abx932050	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPS17 Antibody
ABD9118	Lifescience Market	100 ug	EUR 438

anti-RPS17
YF-PA24629	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPS17

anti-RPS17
YF-PA24630	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPS17

RPS17 Blocking Peptide
DF9118-BP	Affbiotech	1mg	EUR 195

RPS17 Blocking Peptide
20-abx064295	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RPS17 Conjugated Antibody
C45724	SAB	100ul	EUR 397

RPS17 cloning plasmid
CSB-CL020380HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 408 Sequence: atgggccgcgttcgcaccaaaaccgtgaagaaggcggcccgggtcatcatagaaaagtactacacgcgcctgggcaacgacttccacacgaacaagcgcgtgtgcgaggagatcgccattatccccagcaaaaagctccgcaacaagatagcaggttatgtcacgcatctgatgaa Show more
Description: A cloning plasmid for the RPS17 gene.

RPS17 cloning plasmid
CSB-CL020380HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 408 Sequence: atgggccgcgttcgcaccaaaaccgtgaagaaggcggcccgggtcatcatagaaaagtactacacgcgcctgggcaacgacttccacacgaacaagcgcgtgtgcgaggagatcgccattatccccagcaaaaagctccgcaacaagatagcaggttatgtcacgcatctgatgaa Show more
Description: A cloning plasmid for the RPS17 gene.

RPS17 Rabbit pAb
A16425-100ul	Abclonal	100 ul	EUR 308

RPS17 Rabbit pAb
A16425-200ul	Abclonal	200 ul	EUR 459

RPS17 Rabbit pAb
A16425-20ul	Abclonal	20 ul	EUR 183

RPS17 Rabbit pAb
A16425-50ul	Abclonal	50 ul	EUR 223

RPS17 Rabbit pAb
A16426-100ul	Abclonal	100 ul	EUR 308

RPS17 Rabbit pAb
A16426-200ul	Abclonal	200 ul	EUR 459

RPS17 Rabbit pAb
A16426-20ul	Abclonal	20 ul	EUR 183

RPS17 Rabbit pAb
A16426-50ul	Abclonal	50 ul	EUR 223

Anti-RPS17 antibody
STJ118865	St John's Laboratory	100 µl	EUR 277

Anti-RPS17 antibody
STJ118866	St John's Laboratory	100 µl	EUR 277

Anti-RPS17 (2C7)
YF-MA10800	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to RPS17

Anti-RPS17 (1B11)
YF-MA15276	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPS17

Anti-RPS17 (2C7)
YF-MA20413	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to RPS17

Canine RPS17 ELISA KIT
ELI-30194d	Lifescience Market	96 Tests	EUR 928

Mouse RPS17 shRNA Plasmid
20-abx972513	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPS17 shRNA Plasmid
20-abx985405	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RPS17 shRNA Plasmid
20-abx954186	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-RPS17 Plasmid
PVT16216	Lifescience Market	2 ug	EUR 325

RPS17 Recombinant Protein (Human)
RP027127	ABM	100 ug	Ask for price

RPS17 Recombinant Protein (Human)
RP027130	ABM	100 ug	Ask for price

RPS17 Recombinant Protein (Mouse)
RP169202	ABM	100 ug	Ask for price

RPS17 Recombinant Protein (Rat)
RP226805	ABM	100 ug	Ask for price

Ribosomal Protein S17 (RPS17) Antibody
20-abx007739	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ribosomal Protein S17 (RPS17) Antibody
20-abx218366	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Rps17 ORF Vector (Rat) (pORF)
ORF075603	ABM	1.0 ug DNA	EUR 506

RPS17 ORF Vector (Human) (pORF)
ORF009043	ABM	1.0 ug DNA	EUR 95

RPS17 ORF Vector (Human) (pORF)
ORF009044	ABM	1.0 ug DNA	EUR 95

Rps17 ORF Vector (Mouse) (pORF)
ORF056402	ABM	1.0 ug DNA	EUR 506

Rps17 sgRNA CRISPR Lentivector set (Rat)
K6838801	ABM	3 x 1.0 ug	EUR 339

Rps17 sgRNA CRISPR Lentivector set (Mouse)
K4395501	ABM	3 x 1.0 ug	EUR 339

RPS17 sgRNA CRISPR Lentivector set (Human)
K2035801	ABM	3 x 1.0 ug	EUR 339

Pig Ribosomal Protein S17 (RPS17) ELISA Kit
abx520477-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rps17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6838802	ABM	1.0 ug DNA	EUR 154

Rps17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6838803	ABM	1.0 ug DNA	EUR 154

Rps17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6838804	ABM	1.0 ug DNA	EUR 154

Rps17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4395502	ABM	1.0 ug DNA	EUR 154

Rps17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4395503	ABM	1.0 ug DNA	EUR 154

Rps17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4395504	ABM	1.0 ug DNA	EUR 154

RPS17 sgRNA CRISPR Lentivector (Human) (Target 1)
K2035802	ABM	1.0 ug DNA	EUR 154

RPS17 sgRNA CRISPR Lentivector (Human) (Target 2)
K2035803	ABM	1.0 ug DNA	EUR 154

RPS17 sgRNA CRISPR Lentivector (Human) (Target 3)
K2035804	ABM	1.0 ug DNA	EUR 154

RPS17 Protein Vector (Rat) (pPB-C-His)
PV302410	ABM	500 ng	EUR 603

RPS17 Protein Vector (Rat) (pPB-N-His)
PV302411	ABM	500 ng	EUR 603

RPS17 Protein Vector (Rat) (pPM-C-HA)
PV302412	ABM	500 ng	EUR 603

RPS17 Protein Vector (Rat) (pPM-C-His)
PV302413	ABM	500 ng	EUR 603

RPS17 Protein Vector (Mouse) (pPB-C-His)
PV225606	ABM	500 ng	EUR 603

RPS17 Protein Vector (Mouse) (pPB-N-His)
PV225607	ABM	500 ng	EUR 603

RPS17 Protein Vector (Mouse) (pPM-C-HA)
PV225608	ABM	500 ng	EUR 603

RPS17 Protein Vector (Mouse) (pPM-C-His)
PV225609	ABM	500 ng	EUR 603

RPS17 Protein Vector (Human) (pPB-C-His)
PV036169	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPB-N-His)
PV036170	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPM-C-HA)
PV036171	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPM-C-His)
PV036172	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPB-C-His)
PV036173	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPB-N-His)
PV036174	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPM-C-HA)
PV036175	ABM	500 ng	EUR 329

RPS17 Protein Vector (Human) (pPM-C-His)
PV036176	ABM	500 ng	EUR 329

Rps17 3'UTR Luciferase Stable Cell Line
TU118142	ABM	1.0 ml	Ask for price

Rps17 3'UTR GFP Stable Cell Line
TU168142	ABM	1.0 ml	Ask for price

Rps17 3'UTR Luciferase Stable Cell Line
TU219684	ABM	1.0 ml	Ask for price

Rps17 3'UTR GFP Stable Cell Line
TU269684	ABM	1.0 ml	Ask for price

RPS17 3'UTR GFP Stable Cell Line
TU072039	ABM	1.0 ml	EUR 1394

RPS17 3'UTR Luciferase Stable Cell Line
TU022039	ABM	1.0 ml	EUR 1394

Rabbit 40S ribosomal protein S17(RPS17) ELISA kit
E04R0131-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S17(RPS17) ELISA kit
E04R0131-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S17(RPS17) ELISA kit
E04R0131-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S17(RPS17) ELISA kit
E02R0131-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S17(RPS17) ELISA kit
E02R0131-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S17(RPS17) ELISA kit
E02R0131-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S17(RPS17) ELISA kit
E03R0131-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.