  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS17 Antibody
ABD9118 100 ug
EUR 438
RPS17 antibody
70R-51420 100 ul
EUR 244
Description: Purified Polyclonal RPS17 antibody
RPS17 Antibody
45724-100ul 100ul
EUR 252
RPS17 Antibody
45724-50ul 50ul
EUR 187
RPS17 Antibody
DF9118 200ul
EUR 304
Description: RPS17 Antibody detects endogenous levels of total RPS17.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA24629 50 ul
EUR 334
Description: Mouse polyclonal to RPS17
YF-PA24630 50 ul
EUR 334
Description: Mouse polyclonal to RPS17
RPS17 Conjugated Antibody
C45724 100ul
EUR 397
RPS17 cloning plasmid
CSB-CL020380HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atgggccgcgttcgcaccaaaaccgtgaagaaggcggcccgggtcatcatagaaaagtactacacgcgcctgggcaacgacttccacacgaacaagcgcgtgtgcgaggagatcgccattatccccagcaaaaagctccgcaacaagatagcaggttatgtcacgcatctgatgaa
  • Show more
Description: A cloning plasmid for the RPS17 gene.
RPS17 cloning plasmid
CSB-CL020380HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atgggccgcgttcgcaccaaaaccgtgaagaaggcggcccgggtcatcatagaaaagtactacacgcgcctgggcaacgacttccacacgaacaagcgcgtgtgcgaggagatcgccattatccccagcaaaaagctccgcaacaagatagcaggttatgtcacgcatctgatgaa
  • Show more
Description: A cloning plasmid for the RPS17 gene.
RPS17 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS17 Rabbit pAb
A16425-100ul 100 ul
EUR 308
RPS17 Rabbit pAb
A16425-200ul 200 ul
EUR 459
RPS17 Rabbit pAb
A16425-20ul 20 ul
EUR 183
RPS17 Rabbit pAb
A16425-50ul 50 ul
EUR 223
RPS17 Rabbit pAb
A16426-100ul 100 ul
EUR 308
RPS17 Rabbit pAb
A16426-200ul 200 ul
EUR 459
RPS17 Rabbit pAb
A16426-20ul 20 ul
EUR 183
RPS17 Rabbit pAb
A16426-50ul 50 ul
EUR 223
RPS17 Blocking Peptide
DF9118-BP 1mg
EUR 195
Anti-RPS17 antibody
STJ118865 100 µl
EUR 277
Anti-RPS17 antibody
STJ118866 100 µl
EUR 277
Anti-RPS17 (1B11)
YF-MA15276 100 ug
EUR 363
Description: Mouse monoclonal to RPS17
Anti-RPS17 (2C7)
YF-MA20413 200 ul
EUR 363
Description: Mouse monoclonal to RPS17
Anti-RPS17 (2C7)
YF-MA10800 50 ug
EUR 363
Description: Mouse monoclonal to RPS17
Rat RPS17 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-30194d 96 Tests
EUR 928
Human RPS17 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RPS17 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS17 Recombinant Protein (Human)
RP027127 100 ug Ask for price
RPS17 Recombinant Protein (Human)
RP027130 100 ug Ask for price
RPS17 Recombinant Protein (Rat)
RP226805 100 ug Ask for price
pCMV-SPORT6-RPS17 Plasmid
PVT16216 2 ug
EUR 325
RPS17 Recombinant Protein (Mouse)
RP169202 100 ug Ask for price
Ribosomal Protein S17 (RPS17) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S17 (RPS17) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS17 ORF Vector (Human) (pORF)
ORF009043 1.0 ug DNA
EUR 95
RPS17 ORF Vector (Human) (pORF)
ORF009044 1.0 ug DNA
EUR 95
Rps17 ORF Vector (Mouse) (pORF)
ORF056402 1.0 ug DNA
EUR 506
Rps17 ORF Vector (Rat) (pORF)
ORF075603 1.0 ug DNA
EUR 506
RPS17 sgRNA CRISPR Lentivector set (Human)
K2035801 3 x 1.0 ug
EUR 339
Rps17 sgRNA CRISPR Lentivector set (Mouse)
K4395501 3 x 1.0 ug
EUR 339
Rps17 sgRNA CRISPR Lentivector set (Rat)
K6838801 3 x 1.0 ug
EUR 339
Pig Ribosomal Protein S17 (RPS17) ELISA Kit
abx520477-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
RPS17 sgRNA CRISPR Lentivector (Human) (Target 1)
K2035802 1.0 ug DNA
EUR 154
RPS17 sgRNA CRISPR Lentivector (Human) (Target 2)
K2035803 1.0 ug DNA
EUR 154
RPS17 sgRNA CRISPR Lentivector (Human) (Target 3)
K2035804 1.0 ug DNA
EUR 154
Rps17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4395502 1.0 ug DNA
EUR 154
Rps17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4395503 1.0 ug DNA
EUR 154
Rps17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4395504 1.0 ug DNA
EUR 154
Rps17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6838802 1.0 ug DNA
EUR 154
Rps17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6838803 1.0 ug DNA
EUR 154
Rps17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6838804 1.0 ug DNA
EUR 154
RPS17 Protein Vector (Human) (pPB-C-His)
PV036169 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPB-N-His)
PV036170 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPM-C-HA)
PV036171 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPM-C-His)
PV036172 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPB-C-His)
PV036173 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPB-N-His)
PV036174 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPM-C-HA)
PV036175 500 ng
EUR 329
RPS17 Protein Vector (Human) (pPM-C-His)
PV036176 500 ng
EUR 329
RPS17 Protein Vector (Rat) (pPB-C-His)
PV302410 500 ng
EUR 603
RPS17 Protein Vector (Rat) (pPB-N-His)
PV302411 500 ng
EUR 603
RPS17 Protein Vector (Rat) (pPM-C-HA)
PV302412 500 ng
EUR 603
RPS17 Protein Vector (Rat) (pPM-C-His)
PV302413 500 ng
EUR 603
RPS17 Protein Vector (Mouse) (pPB-C-His)
PV225606 500 ng
EUR 603
RPS17 Protein Vector (Mouse) (pPB-N-His)
PV225607 500 ng
EUR 603
RPS17 Protein Vector (Mouse) (pPM-C-HA)
PV225608 500 ng
EUR 603
RPS17 Protein Vector (Mouse) (pPM-C-His)
PV225609 500 ng
EUR 603
Rps17 3'UTR GFP Stable Cell Line
TU168142 1.0 ml Ask for price
RPS17 3'UTR Luciferase Stable Cell Line
TU022039 1.0 ml
EUR 1394
Rps17 3'UTR Luciferase Stable Cell Line
TU118142 1.0 ml Ask for price
RPS17 3'UTR GFP Stable Cell Line
TU072039 1.0 ml
EUR 1394
Rps17 3'UTR Luciferase Stable Cell Line
TU219684 1.0 ml Ask for price
Rps17 3'UTR GFP Stable Cell Line
TU269684 1.0 ml Ask for price
Rat 40S ribosomal protein S17(RPS17) ELISA kit
E02R0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S17(RPS17) ELISA kit
E02R0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S17(RPS17) ELISA kit
E02R0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S17(RPS17) ELISA kit
E03R0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S17(RPS17) ELISA kit
E03R0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S17(RPS17) ELISA kit
E03R0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S17(RPS17) ELISA kit
E04R0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S17(RPS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.