RAB27A

RAB27A siRNA

20-abx904418
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB27A siRNA

20-abx930628
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB27A siRNA

20-abx930629
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB27A antibody

70R-19696 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB27A antibody

RAB27A antibody

70R-5770 50 ug
EUR 467.00
Description: Rabbit polyclonal RAB27A antibody raised against the middle region of RAB27A

RAB27A Antibody

ABD6702 100 ug
EUR 438.00

RAB27A Antibody

1-CSB-PA946810
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB27A Antibody

1-CSB-PA660209
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB27A Antibody

DF6702 200ul
EUR 304.00
Description: RAB27A Antibody detects endogenous levels of total RAB27A.

RAB27A antibody

10R-11450 50 ul
EUR 241.00
Description: Mouse Monoclonal RAB27A antibody

RAB27A Antibody

35464-100ul 100ul
EUR 390.00

RAB27A Antibody

32507-100ul 100ul
EUR 252.00

RAB27A Antibody

1-CSB-PA019177GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

RAB27A Antibody

1-CSB-PA019177LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx215736-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx237009-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx237010-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

20-abx241909
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

20-abx241910
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

20-abx302370
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx016119-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx031478-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx031478-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

abx037347-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family (RAB27A) Antibody

20-abx001580
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab27A, Member Ras Oncogene Family (RAB27A) Antibody

20-abx114974
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB27A Polyclonal Antibody

E-AB-11514-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the small GTPase superfamily, Rab family. The protein is memb
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB27A for WB,IHC,ELISA applications.

RAB27A Polyclonal Antibody

E-AB-11514-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the small GTPase superfamily, Rab family. The protein is memb
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB27A for WB,IHC,ELISA applications.

RAB27A Polyclonal Antibody

E-AB-11514-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the small GTPase superfamily, Rab family. The protein is memb
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB27A for WB,IHC,ELISA applications.

RAB27A Antibody (HRP)

20-abx317165
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB27A Antibody (FITC)

20-abx317166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB27A Antibody (Biotin)

20-abx317167
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB27A-specific Antibody

abx237011-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-RAB27A Antibody

A01608-1 100ug/vial
EUR 334.00

RAB27A Blocking Peptide

DF6702-BP 1mg
EUR 195.00

RAB27A Blocking Peptide

33R-8704 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB27A antibody, catalog no. 70R-5770

Human RAB27A Antibody

33086-05111 150 ug
EUR 261.00

RAB27A cloning plasmid

CSB-CL019177HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 666
  • Sequence: atgtctgatggagattatgattacctcatcaagtttttagctttgggagactctggtgtagggaagaccagtgtactttaccaatatacagatggtaaatttaactccaaatttatcacaacagtgggcattgatttcagggaaaaaagagtggtgtacagagccagtgggccgga
  • Show more
Description: A cloning plasmid for the RAB27A gene.

RAB27A Conjugated Antibody

C32507 100ul
EUR 397.00

Anti-RAB27A antibody

PAab07009 100 ug
EUR 412.00

anti- RAB27A antibody

FNab07009 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:10 - 1:100
  • Immunogen: RAB27A, member RAS oncogene family
  • Uniprot ID: P51159
  • Gene ID: 5873
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB27A

anti- RAB27A antibody

FNab07010 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500-1:2000
  • IP:1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: RAB27A, member RAS oncogene family
  • Uniprot ID: P51159
  • Gene ID: 5873
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB27A

Anti-Rab27a antibody

STJ140075 100 µg
EUR 270.00
Description: Goat polyclonal antibody to mouse Rab27a. Rab27a belongs to the small GTPase superfamily, Rab family. The protein is membrane-bound and involved in lysosome-related vesicle transport and small GTPase mediated signal transduction.

Anti-Rab27a antibody

STJ140077 100 µg
EUR 231.00
Description: Goat polyclonal antibody to mouse Rab27a. Rab27a belongs to the small GTPase superfamily, Rab family. The protein is membrane-bound and involved in lysosome-related vesicle transport and small GTPase mediated signal transduction.

Anti-RAB27A antibody

STJ25258 100 µl
EUR 413.00
Description: The protein encoded by this gene belongs to the small GTPase superfamily, Rab family. The protein is membrane-bound and may be involved in protein transport and small GTPase mediated signal transduction. Mutations in this gene are associated with Griscelli syndrome type 2. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified.

Anti-RAB27A (1G7)

YF-MA10765 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB27A

Anti-RAB27A (4C1)

YF-MA15084 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB27A

Mouse RAB27A shRNA Plasmid

20-abx969250
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB27A shRNA Plasmid

20-abx953963
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB27A protein (His tag)

80R-1320 100 ug
EUR 268.00
Description: Purified recombinant Human RAB27A protein

RAB27A Antibody, HRP conjugated

1-CSB-PA019177LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB27A Antibody, FITC conjugated

1-CSB-PA019177LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB27A Antibody, Biotin conjugated

1-CSB-PA019177LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB27A. Recognizes RAB27A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RAB27A shRNA Plasmid

20-abx985740
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-RAB27A-specific antibody

PAab07011 100 ug
EUR 355.00

anti- RAB27A-specific antibody

FNab07011 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: RAB27A, member RAS oncogene family
  • Uniprot ID: P51159
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB27A-specific

Canine RAB27A ELISA KIT

ELI-52236d 96 Tests
EUR 928.00

RAB27A ELISA KIT|Human

EF002227 96 Tests
EUR 689.00

RAB27A Recombinant Protein (Rat)

RP223289 100 ug Ask for price

RAB27A Recombinant Protein (Human)

RP042673 100 ug Ask for price

RAB27A Recombinant Protein (Mouse)

RP166241 100 ug Ask for price

[KO Validated] RAB27A Rabbit pAb

A1934-100ul 100 ul
EUR 410.00

[KO Validated] RAB27A Rabbit pAb

A1934-200ul 200 ul
EUR 571.00

[KO Validated] RAB27A Rabbit pAb

A1934-20ul 20 ul
EUR 221.00

[KO Validated] RAB27A Rabbit pAb

A1934-50ul 50 ul
EUR 287.00

Human RAB27A Antibody (Biotin Conjugate)

33086-05121 150 ug
EUR 369.00

Monoclonal RAB27A Antibody, Clone: 4D3F11

APR13044G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human RAB27A. The antibodies are raised in Mouse and are from clone 4D3F11. This antibody is applicable in WB, E

Monoclonal RAB27A Antibody, Clone: 7D7C9

AMM02987G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human RAB27A. The antibodies are raised in Mouse and are from clone 7D7C9. This antibody is applicable in WB and IHC, E

Monoclonal RAB27A Antibody, Clone: 1590CT813.266.26

AMM07444G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human RAB27A. The antibodies are raised in Mouse and are from clone 1590CT813.266.26. This antibody is applicable in FC, WB, E

Polyclonal RAB27A Antibody (C-term)

AMM07455G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB27A (C-term). This antibody is tested and proven to work in the following applications:

RAB27A ORF Vector (Human) (pORF)

ORF014225 1.0 ug DNA
EUR 354.00

Anti-RAB27A Antibody (monoclonal, 2F5)

M01608 100ug/vial
EUR 334.00

Rab27a ORF Vector (Mouse) (pORF)

ORF055415 1.0 ug DNA
EUR 506.00

Rab27a ORF Vector (Rat) (pORF)

ORF074431 1.0 ug DNA
EUR 506.00

RAB27A, Member RAS Oncogene Family Protein

20-abx260595
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human RAB27A AssayLite Antibody (FITC Conjugate)

33086-05141 150 ug
EUR 428.00

Human RAB27A AssayLite Antibody (RPE Conjugate)

33086-05151 150 ug
EUR 428.00

Human RAB27A AssayLite Antibody (APC Conjugate)

33086-05161 150 ug
EUR 428.00

Human RAB27A AssayLite Antibody (PerCP Conjugate)

33086-05171 150 ug
EUR 471.00

Polyclonal RAB27A / RAB27 Antibody (C-Terminus)

AMM07443G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RAB27A / RAB27 (C-Terminus). This antibody is tested and proven to work in the following applications:

RAB27A sgRNA CRISPR Lentivector set (Human)

K1772901 3 x 1.0 ug
EUR 339.00

Rab27a sgRNA CRISPR Lentivector set (Rat)

K7611001 3 x 1.0 ug
EUR 339.00

Rab27a sgRNA CRISPR Lentivector set (Mouse)

K3783401 3 x 1.0 ug
EUR 339.00

Recombinant Human RAB27A, Member RAS Oncogene Family

7-06022 5µg Ask for price

Recombinant Human RAB27A, Member RAS Oncogene Family

7-06023 25µg Ask for price