RPL12

RPL12 siRNA
20-abx904647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL12 antibody
70R-33941	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL12 antibody

RPL12 Antibody
ABD3697	Lifescience Market	100 ug	EUR 438

RPL12 Antibody
34346-100ul	SAB	100ul	EUR 252

RPL12 Antibody
34346-50ul	SAB	50ul	EUR 187

RPL12 antibody
70R-19963	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL12 antibody

RPL12 siRNA
20-abx931913	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL12 siRNA
20-abx931914	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL12 Antibody
DF3697	Affbiotech	200ul	EUR 304
Description: RPL12 Antibody detects endogenous levels of total RPL12.

RPL12 Antibody
1-CSB-PA003979	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL12 Antibody
1-CSB-PA020116GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL12 Antibody
1-CSB-PA020116LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPL12 Conjugated Antibody
C34346	SAB	100ul	EUR 397

RPL12 cloning plasmid
CSB-CL020116HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 399 Sequence: atgccgccgaagttcgaccccaacgagatcaaagtcgtatacctgaggtgcaccggaggtgaagtcggtgccacttctgccctggcccccaagatcggccccctgggtctgattgaggtggtgccttctgcctctgccctgatcatcaaagccctcaaggaaccaccaagagacag Show more
Description: A cloning plasmid for the RPL12 gene.

anti- RPL12 antibody
FNab07411	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L12 Uniprot ID: P30050 Gene ID: 6136 Research Area: Metabolism
Description: Antibody raised against RPL12

RPL12 Blocking Peptide
20-abx162024	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-RPL12 Antibody
A07613	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RPL12 Antibody. Validated in WB and tested in Human, Mouse.

RPL12 Blocking Peptide
DF3697-BP	Affbiotech	1mg	EUR 195

Anti-RPL12 antibody
PAab07411	Lifescience Market	100 ug	EUR 386

Mouse RPL12 shRNA Plasmid
20-abx983026	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL12 ELISA KIT|Human
EF002569	Lifescience Market	96 Tests	EUR 689

Canine RPL12 ELISA KIT
ELI-42595d	Lifescience Market	96 Tests	EUR 928

Human RPL12 shRNA Plasmid
20-abx954127	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL12 protein (His tag)
80R-2677	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant RPL12 protein (His tag)

Rat RPL12 shRNA Plasmid
20-abx990927	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL12 Antibody, HRP conjugated
1-CSB-PA020116LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL12 Antibody, FITC conjugated
1-CSB-PA020116LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL12 Antibody, Biotin conjugated
1-CSB-PA020116LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL12 Recombinant Protein (Human)
RP026824	ABM	100 ug	Ask for price

RPL12 Recombinant Protein (Rat)
RP226601	ABM	100 ug	Ask for price

RPL12 Recombinant Protein (Mouse)
RP168962	ABM	100 ug	Ask for price

Ribosomal Protein L12 (RPL12) Antibody
20-abx115224	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody
20-abx133315	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody
20-abx014113	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody
abx028707-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody
abx028707-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody
20-abx328889	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody
abx237411-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein L12 (RPL12) Antibody
20-abx301841	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL12 ORF Vector (Human) (pORF)
ORF008942	ABM	1.0 ug DNA	EUR 95

Rpl12 ORF Vector (Mouse) (pORF)
ORF056322	ABM	1.0 ug DNA	EUR 506

Rpl12 ORF Vector (Rat) (pORF)
ORF075535	ABM	1.0 ug DNA	EUR 506

Ribosomal Protein L12 (RPL12) Antibody (HRP)
20-abx315984	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody (FITC)
20-abx315985	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody (Biotin)
20-abx315986	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL12 sgRNA CRISPR Lentivector set (Human)
K1901501	ABM	3 x 1.0 ug	EUR 339

Rpl12 sgRNA CRISPR Lentivector set (Mouse)
K4807301	ABM	3 x 1.0 ug	EUR 339

Rpl12 sgRNA CRISPR Lentivector set (Rat)
K6750501	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein L12 (RPL12) ELISA Kit
abx382898-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

RPL12 sgRNA CRISPR Lentivector (Human) (Target 1)
K1901502	ABM	1.0 ug DNA	EUR 154

RPL12 sgRNA CRISPR Lentivector (Human) (Target 2)
K1901503	ABM	1.0 ug DNA	EUR 154

RPL12 sgRNA CRISPR Lentivector (Human) (Target 3)
K1901504	ABM	1.0 ug DNA	EUR 154

Rpl12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4807302	ABM	1.0 ug DNA	EUR 154

Rpl12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4807303	ABM	1.0 ug DNA	EUR 154

Rpl12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4807304	ABM	1.0 ug DNA	EUR 154

Rpl12 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6750502	ABM	1.0 ug DNA	EUR 154

Rpl12 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6750503	ABM	1.0 ug DNA	EUR 154

Rpl12 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6750504	ABM	1.0 ug DNA	EUR 154

RPL12 Ribosomal Protein L12 Human Recombinant Protein
PROTP30050	BosterBio	Regular: 10ug	EUR 317
Description: RPL12 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 188 amino acids (1-165 a.a) and having a molecular mass of 20.2kDa. RPL12 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL12 Protein Vector (Human) (pPB-C-His)
PV035765	ABM	500 ng	EUR 329

RPL12 Protein Vector (Human) (pPB-N-His)
PV035766	ABM	500 ng	EUR 329

RPL12 Protein Vector (Human) (pPM-C-HA)
PV035767	ABM	500 ng	EUR 329

RPL12 Protein Vector (Human) (pPM-C-His)
PV035768	ABM	500 ng	EUR 329

Recombinant Human RPL12 Protein, His, E.coli-10ug
QP13341-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human RPL12 Protein, His, E.coli-1mg
QP13341-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human RPL12 Protein, His, E.coli-2ug
QP13341-2ug	EnQuireBio	2ug	EUR 155

RPL12 Protein Vector (Rat) (pPB-C-His)
PV302138	ABM	500 ng	EUR 603

RPL12 Protein Vector (Rat) (pPB-N-His)
PV302139	ABM	500 ng	EUR 603

RPL12 Protein Vector (Rat) (pPM-C-HA)
PV302140	ABM	500 ng	EUR 603

RPL12 Protein Vector (Rat) (pPM-C-His)
PV302141	ABM	500 ng	EUR 603

RPL12 Protein Vector (Mouse) (pPB-C-His)
PV225286	ABM	500 ng	EUR 603

RPL12 Protein Vector (Mouse) (pPB-N-His)
PV225287	ABM	500 ng	EUR 603

RPL12 Protein Vector (Mouse) (pPM-C-HA)
PV225288	ABM	500 ng	EUR 603

RPL12 Protein Vector (Mouse) (pPM-C-His)
PV225289	ABM	500 ng	EUR 603

Rpl12 3'UTR GFP Stable Cell Line
TU168073	ABM	1.0 ml	Ask for price

RPL12 3'UTR Luciferase Stable Cell Line
TU020694	ABM	1.0 ml	EUR 1394

Rpl12 3'UTR Luciferase Stable Cell Line
TU118073	ABM	1.0 ml	Ask for price

RPL12 3'UTR GFP Stable Cell Line
TU070694	ABM	1.0 ml	EUR 1394

Rpl12 3'UTR Luciferase Stable Cell Line
TU219616	ABM	1.0 ml	Ask for price

Rpl12 3'UTR GFP Stable Cell Line
TU269616	ABM	1.0 ml	Ask for price

Rat 60S ribosomal protein L12(RPL12) ELISA kit
E02R0433-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L12(RPL12) ELISA kit
E02R0433-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L12(RPL12) ELISA kit
E02R0433-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L12(RPL12) ELISA kit
E03R0433-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L12(RPL12) ELISA kit
E03R0433-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.