  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL12 antibody

70R-33941 100 ug
EUR 327.00
Description: Rabbit polyclonal RPL12 antibody

RPL12 Antibody

ABD3697 100 ug
EUR 438.00

RPL12 Antibody

34346-100ul 100ul
EUR 252.00

RPL12 Antibody

34346-50ul 50ul
EUR 187.00

RPL12 antibody

70R-19963 50 ul
EUR 435.00
Description: Rabbit polyclonal RPL12 antibody


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL12 Antibody

DF3697 200ul
EUR 304.00
Description: RPL12 Antibody detects endogenous levels of total RPL12.

RPL12 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL12 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL12 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPL12 Conjugated Antibody

C34346 100ul
EUR 397.00

RPL12 cloning plasmid

CSB-CL020116HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 399
  • Sequence: atgccgccgaagttcgaccccaacgagatcaaagtcgtatacctgaggtgcaccggaggtgaagtcggtgccacttctgccctggcccccaagatcggccccctgggtctgattgaggtggtgccttctgcctctgccctgatcatcaaagccctcaaggaaccaccaagagacag
  • Show more
Description: A cloning plasmid for the RPL12 gene.

anti- RPL12 antibody

FNab07411 100µg
EUR 548.75
  • Immunogen: ribosomal protein L12
  • Uniprot ID: P30050
  • Gene ID: 6136
  • Research Area: Metabolism
Description: Antibody raised against RPL12

RPL12 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-RPL12 Antibody

A07613 100ul
EUR 397.00
Description: Rabbit Polyclonal RPL12 Antibody. Validated in WB and tested in Human, Mouse.

RPL12 Blocking Peptide

DF3697-BP 1mg
EUR 195.00

Anti-RPL12 antibody

PAab07411 100 ug
EUR 386.00

Mouse RPL12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF002569 96 Tests
EUR 689.00


ELI-42595d 96 Tests
EUR 928.00

Human RPL12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL12 protein (His tag)

80R-2677 50 ug
EUR 424.00
Description: Purified recombinant RPL12 protein (His tag)

Rat RPL12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL12. Recognizes RPL12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL12 Recombinant Protein (Human)

RP026824 100 ug Ask for price

RPL12 Recombinant Protein (Rat)

RP226601 100 ug Ask for price

RPL12 Recombinant Protein (Mouse)

RP168962 100 ug Ask for price

Ribosomal Protein L12 (RPL12) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody

abx028707-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody

abx028707-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody

abx237411-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Ribosomal Protein L12 (RPL12) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RPL12 ORF Vector (Human) (pORF)

ORF008942 1.0 ug DNA
EUR 95.00

Rpl12 ORF Vector (Mouse) (pORF)

ORF056322 1.0 ug DNA
EUR 506.00

Rpl12 ORF Vector (Rat) (pORF)

ORF075535 1.0 ug DNA
EUR 506.00

Ribosomal Protein L12 (RPL12) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ribosomal Protein L12 (RPL12) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RPL12 sgRNA CRISPR Lentivector set (Human)

K1901501 3 x 1.0 ug
EUR 339.00

Rpl12 sgRNA CRISPR Lentivector set (Mouse)

K4807301 3 x 1.0 ug
EUR 339.00

Rpl12 sgRNA CRISPR Lentivector set (Rat)

K6750501 3 x 1.0 ug
EUR 339.00

Human Ribosomal Protein L12 (RPL12) ELISA Kit

abx382898-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

RPL12 sgRNA CRISPR Lentivector (Human) (Target 1)

K1901502 1.0 ug DNA
EUR 154.00

RPL12 sgRNA CRISPR Lentivector (Human) (Target 2)

K1901503 1.0 ug DNA
EUR 154.00

RPL12 sgRNA CRISPR Lentivector (Human) (Target 3)

K1901504 1.0 ug DNA
EUR 154.00

Rpl12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4807302 1.0 ug DNA
EUR 154.00

Rpl12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4807303 1.0 ug DNA
EUR 154.00

Rpl12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4807304 1.0 ug DNA
EUR 154.00

Rpl12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6750502 1.0 ug DNA
EUR 154.00

Rpl12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6750503 1.0 ug DNA
EUR 154.00

Rpl12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6750504 1.0 ug DNA
EUR 154.00

RPL12 Ribosomal Protein L12 Human Recombinant Protein

PROTP30050 Regular: 10ug
EUR 317.00
Description: RPL12 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 188 amino acids (1-165 a.a) and having a molecular mass of 20.2kDa. RPL12 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL12 Protein Vector (Human) (pPB-C-His)

PV035765 500 ng
EUR 329.00

RPL12 Protein Vector (Human) (pPB-N-His)

PV035766 500 ng
EUR 329.00

RPL12 Protein Vector (Human) (pPM-C-HA)

PV035767 500 ng
EUR 329.00

RPL12 Protein Vector (Human) (pPM-C-His)

PV035768 500 ng
EUR 329.00

Recombinant Human RPL12 Protein, His, E.coli-10ug

QP13341-10ug 10ug
EUR 201.00

Recombinant Human RPL12 Protein, His, E.coli-1mg

QP13341-1mg 1mg
EUR 5251.00

Recombinant Human RPL12 Protein, His, E.coli-2ug

QP13341-2ug 2ug
EUR 155.00

RPL12 Protein Vector (Rat) (pPB-C-His)

PV302138 500 ng
EUR 603.00

RPL12 Protein Vector (Rat) (pPB-N-His)

PV302139 500 ng
EUR 603.00

RPL12 Protein Vector (Rat) (pPM-C-HA)

PV302140 500 ng
EUR 603.00

RPL12 Protein Vector (Rat) (pPM-C-His)

PV302141 500 ng
EUR 603.00

RPL12 Protein Vector (Mouse) (pPB-C-His)

PV225286 500 ng
EUR 603.00

RPL12 Protein Vector (Mouse) (pPB-N-His)

PV225287 500 ng
EUR 603.00

RPL12 Protein Vector (Mouse) (pPM-C-HA)

PV225288 500 ng
EUR 603.00

RPL12 Protein Vector (Mouse) (pPM-C-His)

PV225289 500 ng
EUR 603.00

Rpl12 3'UTR GFP Stable Cell Line

TU168073 1.0 ml Ask for price

RPL12 3'UTR Luciferase Stable Cell Line

TU020694 1.0 ml
EUR 1394.00

Rpl12 3'UTR Luciferase Stable Cell Line

TU118073 1.0 ml Ask for price

RPL12 3'UTR GFP Stable Cell Line

TU070694 1.0 ml
EUR 1394.00

Rpl12 3'UTR Luciferase Stable Cell Line

TU219616 1.0 ml Ask for price

Rpl12 3'UTR GFP Stable Cell Line

TU269616 1.0 ml Ask for price

Rat 60S ribosomal protein L12(RPL12) ELISA kit

E02R0433-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L12(RPL12) ELISA kit

E02R0433-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L12(RPL12) ELISA kit

E02R0433-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L12(RPL12) ELISA kit

E03R0433-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L12(RPL12) ELISA kit

E03R0433-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L12(RPL12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.