Gemini Genomics

NGS Sequencing


Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

DLR-HSPD1-Hu-96T 96T
EUR 621
  • Should the Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

DLR-HSPD1-Mu-48T 48T
EUR 489
  • Should the Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

DLR-HSPD1-Mu-96T 96T
EUR 635
  • Should the Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

DLR-HSPD1-Ra-48T 48T
EUR 508
  • Should the Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

DLR-HSPD1-Ra-96T 96T
EUR 661
  • Should the Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RDR-HSPD1-Hu-48Tests 48 Tests
EUR 500

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RDR-HSPD1-Hu-96Tests 96 Tests
EUR 692

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RDR-HSPD1-Mu-48Tests 48 Tests
EUR 511

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RDR-HSPD1-Mu-96Tests 96 Tests
EUR 709

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RDR-HSPD1-Ra-48Tests 48 Tests
EUR 534

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RDR-HSPD1-Ra-96Tests 96 Tests
EUR 742

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RD-HSPD1-Hu-48Tests 48 Tests
EUR 478

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RD-HSPD1-Hu-96Tests 96 Tests
EUR 662

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RD-HSPD1-Mu-48Tests 48 Tests
EUR 489

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RD-HSPD1-Mu-96Tests 96 Tests
EUR 677

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RD-HSPD1-Ra-48Tests 48 Tests
EUR 511

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit

RD-HSPD1-Ra-96Tests 96 Tests
EUR 709

Hspd1/ Rat Hspd1 ELISA Kit

ELI-02779r 96 Tests
EUR 886

HSPD1 antibody

70R-17850 50 ul
EUR 435
Description: Rabbit polyclonal HSPD1 antibody

HSPD1 antibody

70R-10514 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HSPD1 antibody

HSPD1 Antibody

32098-100ul 100ul
EUR 252

HSPD1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

HSPD1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

HSPD1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:150

HSPD1 Antibody

DF6151 200ul
EUR 304
Description: HSPD1 Antibody detects endogenous levels of total HSPD1.

HSPD1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

HSPD1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

HSPD1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:150

HSPD1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HSPD1 Antibody

CSB-PA229520-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HSPD1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HSPD1 Antibody

ABD6151 100 ug
EUR 438

HSPD1 Blocking Peptide

33R-7388 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPD1 antibody, catalog no. 70R-10514

HSPD1 Blocking Peptide

DF6151-BP 1mg
EUR 195

HSPD1 Conjugated Antibody

C32098 100ul
EUR 397

HSPD1 cloning plasmid

CSB-CL010847HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgcttcggttacccacagtctttcgccagatgagaccggtgtccagggtactggctcctcatctcactcgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagg
  • Show more
Description: A cloning plasmid for the HSPD1 gene.

HSPD1 cloning plasmid

CSB-CL010847HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgcttcggttacccacagtctttcggcagatgagaccggtgtccagggtactggctcctcatctcacccgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagg
  • Show more
Description: A cloning plasmid for the HSPD1 gene.

HSPD1 cloning plasmid

CSB-CL010847HU3-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgcttcggttacccacagtctttcgccagatgagaccggtgtccagggtactggctcctcatctcacccgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagg
  • Show more
Description: A cloning plasmid for the HSPD1 gene.

Anti-HSPD1 antibody

STJ24105 100 µl
EUR 277
Description: This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.


ELA-E0822h 96 Tests
EUR 824


ELI-02776d 96 Tests
EUR 928


ELI-02777c 96 Tests
EUR 928

Polyclonal HSPD1 / HSP60 Antibody

APR16771G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HSPD1 / HSP60 . This antibody is tested and proven to work in the following applications:

Polyclonal HSPD1 Antibody (Center)

APR16778G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPD1 (Center). This antibody is tested and proven to work in the following applications:

Rat HSPD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HSP60(HSPD1/780) Antibody

BNUM0780-50 50uL
EUR 395
Description: Primary antibody against HSP60(HSPD1/780), 1mg/mL

HSP60(HSPD1/875) Antibody

BNUM0875-50 50uL
EUR 395
Description: Primary antibody against HSP60(HSPD1/875), 1mg/mL

HSP60(HSPD1/780) Antibody

BNUB0780-100 100uL
EUR 209
Description: Primary antibody against HSP60(HSPD1/780), Concentration: 0.2mg/mL

HSP60(HSPD1/780) Antibody

BNUB0780-500 500uL
EUR 458
Description: Primary antibody against HSP60(HSPD1/780), Concentration: 0.2mg/mL

HSP60(HSPD1/875) Antibody

BNUB0875-100 100uL
EUR 209
Description: Primary antibody against HSP60(HSPD1/875), Concentration: 0.2mg/mL

HSP60(HSPD1/875) Antibody

BNUB0875-500 500uL
EUR 458
Description: Primary antibody against HSP60(HSPD1/875), Concentration: 0.2mg/mL

HSP60(HSPD1/780) Antibody

BNC040780-100 100uL
EUR 199
Description: Primary antibody against HSP60(HSPD1/780), CF405S conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody

BNC040780-500 500uL
EUR 544
Description: Primary antibody against HSP60(HSPD1/780), CF405S conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody

BNC040875-100 100uL
EUR 199
Description: Primary antibody against HSP60(HSPD1/875), CF405S conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody

BNC040875-500 500uL
EUR 544
Description: Primary antibody against HSP60(HSPD1/875), CF405S conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody

BNC550780-100 100uL
EUR 199
Description: Primary antibody against HSP60(HSPD1/780), CF555 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody

BNC550780-500 500uL
EUR 544
Description: Primary antibody against HSP60(HSPD1/780), CF555 conjugate, Concentration: 0.1mg/mL