Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
DLR-HSPD1-Hu-96T 96T
EUR 621.00
  • Should the Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
DLR-HSPD1-Mu-48T 48T
EUR 489.00
  • Should the Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
DLR-HSPD1-Mu-96T 96T
EUR 635.00
  • Should the Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
DLR-HSPD1-Ra-48T 48T
EUR 508.00
  • Should the Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
DLR-HSPD1-Ra-96T 96T
EUR 661.00
  • Should the Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RD-HSPD1-Hu-48Tests 48 Tests
EUR 478.00

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RD-HSPD1-Hu-96Tests 96 Tests
EUR 662.00

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RD-HSPD1-Mu-48Tests 48 Tests
EUR 489.00

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RD-HSPD1-Mu-96Tests 96 Tests
EUR 677.00

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RD-HSPD1-Ra-48Tests 48 Tests
EUR 511.00

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RD-HSPD1-Ra-96Tests 96 Tests
EUR 709.00

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RDR-HSPD1-Hu-48Tests 48 Tests
EUR 500.00

Human Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RDR-HSPD1-Hu-96Tests 96 Tests
EUR 692.00

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RDR-HSPD1-Mu-48Tests 48 Tests
EUR 511.00

Mouse Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RDR-HSPD1-Mu-96Tests 96 Tests
EUR 709.00

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RDR-HSPD1-Ra-48Tests 48 Tests
EUR 534.00

Rat Heat Shock 60kD Protein 1, Chaperonin (HSPD1) ELISA Kit
RDR-HSPD1-Ra-96Tests 96 Tests
EUR 742.00

Hspd1/ Rat Hspd1 ELISA Kit
ELI-02779r 96 Tests
EUR 886.00

HSPD1 siRNA
20-abx902574
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HSPD1 siRNA
20-abx920006
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HSPD1 siRNA
20-abx920007
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HSPD1 Antibody
ABD6151 100 ug
EUR 438.00

HSPD1 Antibody
32098-100ul 100ul
EUR 252.00

HSPD1 antibody
70R-17850 50 ul
EUR 435.00
Description: Rabbit polyclonal HSPD1 antibody

HSPD1 antibody
70R-10514 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal HSPD1 antibody

HSPD1 Antibody
DF6151 200ul
EUR 304.00
Description: HSPD1 Antibody detects endogenous levels of total HSPD1.

HSPD1 Antibody
1-CSB-PA890968
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:150

HSPD1 Antibody
1-CSB-PA002990
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

HSPD1 Antibody
1-CSB-PA010847GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HSPD1 Antibody
1-CSB-PA228918
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:150

HSPD1 Antibody
CSB-PA229520-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HSPD1 Antibody
CSB-PA229520-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HSPD1 Antibody
1-CSB-PA160863
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

HSPD1 Antibody
1-CSB-PA199595
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

HSPD1 Antibody
1-CSB-PA080151
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against HSPD1. Recognizes HSPD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

HSPD1 Conjugated Antibody
C32098 100ul
EUR 397.00

HSPD1 cloning plasmid
CSB-CL010847HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgcttcggttacccacagtctttcgccagatgagaccggtgtccagggtactggctcctcatctcactcgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagg
  • Show more
Description: A cloning plasmid for the HSPD1 gene.

HSPD1 cloning plasmid
CSB-CL010847HU2-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgcttcggttacccacagtctttcggcagatgagaccggtgtccagggtactggctcctcatctcacccgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagg
  • Show more
Description: A cloning plasmid for the HSPD1 gene.

HSPD1 cloning plasmid
CSB-CL010847HU3-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgcttcggttacccacagtctttcgccagatgagaccggtgtccagggtactggctcctcatctcacccgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagg
  • Show more
Description: A cloning plasmid for the HSPD1 gene.

HSPD1 Blocking Peptide
33R-7388 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPD1 antibody, catalog no. 70R-10514

HSPD1 Blocking Peptide
DF6151-BP 1mg
EUR 195.00

Anti-HSPD1 antibody
STJ24105 100 µl
EUR 277.00
Description: This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.

Polyclonal HSPD1 / HSP60 Antibody
APR16771G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HSPD1 / HSP60 . This antibody is tested and proven to work in the following applications:

Polyclonal HSPD1 Antibody (Center)
APR16778G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPD1 (Center). This antibody is tested and proven to work in the following applications:

HSP60(HSPD1/780) Antibody
BNC610780-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/780), CF660R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC610780-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/780), CF660R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC610875-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/875), CF660R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC610875-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/875), CF660R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC400780-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/780), CF640R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC400780-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/780), CF640R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC400875-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/875), CF640R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC400875-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/875), CF640R conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC430780-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/780), CF543 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC430780-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/780), CF543 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC430875-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/875), CF543 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC430875-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/875), CF543 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC470780-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/780), CF647 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/780) Antibody
BNC470780-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/780), CF647 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC470875-100 100uL
EUR 199.00
Description: Primary antibody against HSP60(HSPD1/875), CF647 conjugate, Concentration: 0.1mg/mL

HSP60(HSPD1/875) Antibody
BNC470875-500 500uL
EUR 544.00
Description: Primary antibody against HSP60(HSPD1/875), CF647 conjugate, Concentration: 0.1mg/mL