Human Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Hu-96T 96T
EUR 647
  • Should the Human Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-48T 48T
EUR 508
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-96T 96T
EUR 661
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-48T 48T
EUR 528
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-96T 96T
EUR 690
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-48Tests 48 Tests
EUR 522

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-96Tests 96 Tests
EUR 724

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-48Tests 48 Tests
EUR 534

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-96Tests 96 Tests
EUR 742

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-48Tests 48 Tests
EUR 558

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-96Tests 96 Tests
EUR 776

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-48Tests 48 Tests
EUR 500

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-96Tests 96 Tests
EUR 692

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-48Tests 48 Tests
EUR 511

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-96Tests 96 Tests
EUR 709

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-48Tests 48 Tests
EUR 534

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-96Tests 96 Tests
EUR 742

Bovine Growth Hormone (GH) ELISA Kit

DLR-GH-b-48T 48T
EUR 547
  • Should the Bovine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Growth Hormone (GH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Growth Hormone (GH) ELISA Kit

DLR-GH-b-96T 96T
EUR 715
  • Should the Bovine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Growth Hormone (GH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Canine Growth Hormone (GH) ELISA Kit

DLR-GH-c-48T 48T
EUR 527
  • Should the Canine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Canine Growth Hormone (GH) ELISA Kit

DLR-GH-c-96T 96T
EUR 688
  • Should the Canine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Chicken Growth Hormone (GH) ELISA Kit

DLR-GH-Ch-48T 48T
EUR 508
  • Should the Chicken Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Chicken Growth Hormone (GH) ELISA Kit

DLR-GH-Ch-96T 96T
EUR 661
  • Should the Chicken Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Equine Growth Hormone (GH) ELISA Kit

DLR-GH-Eq-48T 48T
EUR 556
  • Should the Equine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Equine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Equine Growth Hormone (GH) ELISA Kit

DLR-GH-Eq-96T 96T
EUR 728
  • Should the Equine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Equine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Human Growth Hormone (GH) ELISA Kit

DLR-GH-Hu-48T 48T
EUR 381
  • Should the Human Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Growth Hormone (GH) ELISA Kit

DLR-GH-Hu-96T 96T
EUR 487
  • Should the Human Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Growth Hormone (GH) ELISA Kit

DLR-GH-Mu-48T 48T
EUR 489
  • Should the Mouse Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Growth Hormone (GH) ELISA Kit

DLR-GH-Mu-96T 96T
EUR 635
  • Should the Mouse Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Growth Hormone (GH) ELISA Kit

DLR-GH-p-48T 48T
EUR 547
  • Should the Porcine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Porcine Growth Hormone (GH) ELISA Kit

DLR-GH-p-96T 96T
EUR 715
  • Should the Porcine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Rat Growth Hormone (GH) ELISA Kit

DLR-GH-Ra-48T 48T
EUR 508
  • Should the Rat Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Rat Growth Hormone (GH) ELISA Kit

DLR-GH-Ra-96T 96T
EUR 661
  • Should the Rat Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Bovine Growth Hormone (GH) ELISA Kit

RDR-GH-b-48Tests 48 Tests
EUR 580

Bovine Growth Hormone (GH) ELISA Kit

RDR-GH-b-96Tests 96 Tests
EUR 807

Canine Growth Hormone (GH) ELISA Kit

RDR-GH-c-48Tests 48 Tests
EUR 557

Canine Growth Hormone (GH) ELISA Kit

RDR-GH-c-96Tests 96 Tests
EUR 774

Chicken Growth Hormone (GH) ELISA Kit

RDR-GH-Ch-48Tests 48 Tests
EUR 534

Chicken Growth Hormone (GH) ELISA Kit

RDR-GH-Ch-96Tests 96 Tests
EUR 742

Equine Growth Hormone (GH) ELISA Kit

RDR-GH-Eq-48Tests 48 Tests
EUR 591

Equine Growth Hormone (GH) ELISA Kit

RDR-GH-Eq-96Tests 96 Tests
EUR 823

Human Growth Hormone (GH) ELISA Kit

RDR-GH-Hu-48Tests 48 Tests
EUR 384

Human Growth Hormone (GH) ELISA Kit

RDR-GH-Hu-96Tests 96 Tests
EUR 527

Mouse Growth Hormone (GH) ELISA Kit

RDR-GH-Mu-48Tests 48 Tests
EUR 511

Mouse Growth Hormone (GH) ELISA Kit

RDR-GH-Mu-96Tests 96 Tests
EUR 709

Porcine Growth Hormone (GH) ELISA Kit

RDR-GH-p-48Tests 48 Tests
EUR 580

Porcine Growth Hormone (GH) ELISA Kit

RDR-GH-p-96Tests 96 Tests
EUR 807

Rat Growth Hormone (GH) ELISA Kit

RDR-GH-Ra-48Tests 48 Tests
EUR 534

Rat Growth Hormone (GH) ELISA Kit

RDR-GH-Ra-96Tests 96 Tests
EUR 742

Bovine Growth Hormone (GH) ELISA Kit

RD-GH-b-48Tests 48 Tests
EUR 555

Bovine Growth Hormone (GH) ELISA Kit

RD-GH-b-96Tests 96 Tests
EUR 771

Canine Growth Hormone (GH) ELISA Kit

RD-GH-c-48Tests 48 Tests
EUR 533

Canine Growth Hormone (GH) ELISA Kit

RD-GH-c-96Tests 96 Tests
EUR 740

Chicken Growth Hormone (GH) ELISA Kit

RD-GH-Ch-48Tests 48 Tests
EUR 511

Chicken Growth Hormone (GH) ELISA Kit

RD-GH-Ch-96Tests 96 Tests
EUR 709

Equine Growth Hormone (GH) ELISA Kit

RD-GH-Eq-48Tests 48 Tests
EUR 566

Equine Growth Hormone (GH) ELISA Kit

RD-GH-Eq-96Tests 96 Tests
EUR 787

Human Growth Hormone (GH) ELISA Kit

RD-GH-Hu-48Tests 48 Tests
EUR 368

Human Growth Hormone (GH) ELISA Kit

RD-GH-Hu-96Tests 96 Tests
EUR 504

Mouse Growth Hormone (GH) ELISA Kit

RD-GH-Mu-48Tests 48 Tests
EUR 489

Mouse Growth Hormone (GH) ELISA Kit

RD-GH-Mu-96Tests 96 Tests
EUR 677

Porcine Growth Hormone (GH) ELISA Kit

RD-GH-p-48Tests 48 Tests
EUR 555

Porcine Growth Hormone (GH) ELISA Kit

RD-GH-p-96Tests 96 Tests
EUR 771

Rat Growth Hormone (GH) ELISA Kit

RD-GH-Ra-48Tests 48 Tests
EUR 511

Rat Growth Hormone (GH) ELISA Kit

RD-GH-Ra-96Tests 96 Tests
EUR 709


CH23000 100 ul
EUR 179


MO20019 100 ul
EUR 278

Chat/ Rat Chat ELISA Kit

ELI-04655r 96 Tests
EUR 886

CHAT antibody

20R-2847 100 ul
EUR 349
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-16378 50 ul
EUR 435
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-10534 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CHAT antibody

ChAT antibody

70R-10625 1 ml
EUR 693
Description: Affinity purified Chicken polyclonal ChAT antibody

CHAT antibody

70R-14948 100 ul
EUR 392
Description: Goat polyclonal CHAT antibody

CHAT Antibody

32673-100ul 100ul
EUR 252

CHAT Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CHAT Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CHAT Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CHAT Antibody

DF6964 200ul
EUR 304
Description: CHAT Antibody detects endogenous levels of total CHAT.

CHAT antibody

70R-49541 100 ul
EUR 244
Description: Purified Polyclonal CHAT antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHAT Antibody

ABD6964 100 ug
EUR 438

Cytomegalovirus gH (CMV gH) Antibody

abx415688-01mg 0.1 mg
EUR 648
  • Shipped within 1 week.

CHAT Rabbit pAb

A13244-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A13244-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A13244-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A13244-50ul 50 ul
EUR 223

CHAT Rabbit pAb

A12420-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A12420-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A12420-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A12420-50ul 50 ul
EUR 223

CHAT Blocking Peptide

33R-8800 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHAT antibody, catalog no. 70R-10534

CHAT Blocking Peptide

DF6964-BP 1mg
EUR 195

CHAT Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHAT Conjugated Antibody

C32673 100ul
EUR 397

CHAT cloning plasmid

CSB-CL005314HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atgacagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.