Human Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Hu-96T 96T
EUR 647.00
  • Should the Human Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-48T 48T
EUR 508.00
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-96T 96T
EUR 661.00
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-48T 48T
EUR 528.00
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-96T 96T
EUR 690.00
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-48Tests 48 Tests
EUR 500.00

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-96Tests 96 Tests
EUR 692.00

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-48Tests 48 Tests
EUR 511.00

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-96Tests 96 Tests
EUR 709.00

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-48Tests 48 Tests
EUR 534.00

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-96Tests 96 Tests
EUR 742.00

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-48Tests 48 Tests
EUR 522.00

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-96Tests 96 Tests
EUR 724.00

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-48Tests 48 Tests
EUR 534.00

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-96Tests 96 Tests
EUR 742.00

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-48Tests 48 Tests
EUR 558.00

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-96Tests 96 Tests
EUR 776.00

Bovine Growth Hormone (GH) ELISA Kit

DLR-GH-b-48T 48T
EUR 547.00
  • Should the Bovine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Growth Hormone (GH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Growth Hormone (GH) ELISA Kit

DLR-GH-b-96T 96T
EUR 715.00
  • Should the Bovine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Growth Hormone (GH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Canine Growth Hormone (GH) ELISA Kit

DLR-GH-c-48T 48T
EUR 527.00
  • Should the Canine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Canine Growth Hormone (GH) ELISA Kit

DLR-GH-c-96T 96T
EUR 688.00
  • Should the Canine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Chicken Growth Hormone (GH) ELISA Kit

DLR-GH-Ch-48T 48T
EUR 508.00
  • Should the Chicken Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Chicken Growth Hormone (GH) ELISA Kit

DLR-GH-Ch-96T 96T
EUR 661.00
  • Should the Chicken Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Equine Growth Hormone (GH) ELISA Kit

DLR-GH-Eq-48T 48T
EUR 556.00
  • Should the Equine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Equine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Equine Growth Hormone (GH) ELISA Kit

DLR-GH-Eq-96T 96T
EUR 728.00
  • Should the Equine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Equine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Human Growth Hormone (GH) ELISA Kit

DLR-GH-Hu-48T 48T
EUR 381.00
  • Should the Human Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Growth Hormone (GH) ELISA Kit

DLR-GH-Hu-96T 96T
EUR 487.00
  • Should the Human Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Growth Hormone (GH) ELISA Kit

DLR-GH-Mu-48T 48T
EUR 489.00
  • Should the Mouse Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Growth Hormone (GH) ELISA Kit

DLR-GH-Mu-96T 96T
EUR 635.00
  • Should the Mouse Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Growth Hormone (GH) ELISA Kit

DLR-GH-p-48T 48T
EUR 547.00
  • Should the Porcine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Porcine Growth Hormone (GH) ELISA Kit

DLR-GH-p-96T 96T
EUR 715.00
  • Should the Porcine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Rat Growth Hormone (GH) ELISA Kit

DLR-GH-Ra-48T 48T
EUR 508.00
  • Should the Rat Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Rat Growth Hormone (GH) ELISA Kit

DLR-GH-Ra-96T 96T
EUR 661.00
  • Should the Rat Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Bovine Growth Hormone (GH) ELISA Kit

RD-GH-b-48Tests 48 Tests
EUR 555.00

Bovine Growth Hormone (GH) ELISA Kit

RD-GH-b-96Tests 96 Tests
EUR 771.00

Canine Growth Hormone (GH) ELISA Kit

RD-GH-c-48Tests 48 Tests
EUR 533.00

Canine Growth Hormone (GH) ELISA Kit

RD-GH-c-96Tests 96 Tests
EUR 740.00

Chicken Growth Hormone (GH) ELISA Kit

RD-GH-Ch-48Tests 48 Tests
EUR 511.00

Chicken Growth Hormone (GH) ELISA Kit

RD-GH-Ch-96Tests 96 Tests
EUR 709.00

Equine Growth Hormone (GH) ELISA Kit

RD-GH-Eq-48Tests 48 Tests
EUR 566.00

Equine Growth Hormone (GH) ELISA Kit

RD-GH-Eq-96Tests 96 Tests
EUR 787.00

Human Growth Hormone (GH) ELISA Kit

RD-GH-Hu-48Tests 48 Tests
EUR 368.00

Human Growth Hormone (GH) ELISA Kit

RD-GH-Hu-96Tests 96 Tests
EUR 504.00

Mouse Growth Hormone (GH) ELISA Kit

RD-GH-Mu-48Tests 48 Tests
EUR 489.00

Mouse Growth Hormone (GH) ELISA Kit

RD-GH-Mu-96Tests 96 Tests
EUR 677.00

Porcine Growth Hormone (GH) ELISA Kit

RD-GH-p-48Tests 48 Tests
EUR 555.00

Porcine Growth Hormone (GH) ELISA Kit

RD-GH-p-96Tests 96 Tests
EUR 771.00

Rat Growth Hormone (GH) ELISA Kit

RD-GH-Ra-48Tests 48 Tests
EUR 511.00

Rat Growth Hormone (GH) ELISA Kit

RD-GH-Ra-96Tests 96 Tests
EUR 709.00

Bovine Growth Hormone (GH) ELISA Kit

RDR-GH-b-48Tests 48 Tests
EUR 580.00

Bovine Growth Hormone (GH) ELISA Kit

RDR-GH-b-96Tests 96 Tests
EUR 807.00

Canine Growth Hormone (GH) ELISA Kit

RDR-GH-c-48Tests 48 Tests
EUR 557.00

Canine Growth Hormone (GH) ELISA Kit

RDR-GH-c-96Tests 96 Tests
EUR 774.00

Chicken Growth Hormone (GH) ELISA Kit

RDR-GH-Ch-48Tests 48 Tests
EUR 534.00

Chicken Growth Hormone (GH) ELISA Kit

RDR-GH-Ch-96Tests 96 Tests
EUR 742.00

Equine Growth Hormone (GH) ELISA Kit

RDR-GH-Eq-48Tests 48 Tests
EUR 591.00

Equine Growth Hormone (GH) ELISA Kit

RDR-GH-Eq-96Tests 96 Tests
EUR 823.00

Human Growth Hormone (GH) ELISA Kit

RDR-GH-Hu-48Tests 48 Tests
EUR 384.00

Human Growth Hormone (GH) ELISA Kit

RDR-GH-Hu-96Tests 96 Tests
EUR 527.00

Mouse Growth Hormone (GH) ELISA Kit

RDR-GH-Mu-48Tests 48 Tests
EUR 511.00

Mouse Growth Hormone (GH) ELISA Kit

RDR-GH-Mu-96Tests 96 Tests
EUR 709.00

Porcine Growth Hormone (GH) ELISA Kit

RDR-GH-p-48Tests 48 Tests
EUR 580.00

Porcine Growth Hormone (GH) ELISA Kit

RDR-GH-p-96Tests 96 Tests
EUR 807.00

Rat Growth Hormone (GH) ELISA Kit

RDR-GH-Ra-48Tests 48 Tests
EUR 534.00

Rat Growth Hormone (GH) ELISA Kit

RDR-GH-Ra-96Tests 96 Tests
EUR 742.00

ChAT

CH23000 100 ul
EUR 179.00

ChAT

MO20019 100 ul
EUR 278.00

Chat/ Rat Chat ELISA Kit

ELI-04655r 96 Tests
EUR 886.00

CHAT siRNA

20-abx911641
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CHAT antibody

70R-49541 100 ul
EUR 244.00
Description: Purified Polyclonal CHAT antibody

CHAT Antibody

ABD6964 100 ug
EUR 438.00

CHAT Antibody

32673-100ul 100ul
EUR 252.00

CHAT antibody

20R-2847 100 ul
EUR 349.00
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-14948 100 ul
EUR 392.00
Description: Goat polyclonal CHAT antibody

CHAT antibody

70R-10534 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CHAT antibody

ChAT antibody

70R-10625 1 ml
EUR 693.00
Description: Affinity purified Chicken polyclonal ChAT antibody

CHAT antibody

70R-16378 50 ul
EUR 435.00
Description: Rabbit polyclonal CHAT antibody

CHAT Antibody

DF6964 200ul
EUR 304.00
Description: CHAT Antibody detects endogenous levels of total CHAT.

CHAT Antibody

1-CSB-PA001637
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CHAT Antibody

1-CSB-PA005314GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CHAT Antibody

1-CSB-PA005314LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Cytomegalovirus gH (CMV gH) Antibody

abx415688-01mg 0.1 mg
EUR 648.00
  • Shipped within 1 week.

CHAT Conjugated Antibody

C32673 100ul
EUR 397.00

CHAT cloning plasmid

CSB-CL005314HU1-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atgacagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.

CHAT cloning plasmid

CSB-CL005314HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggcagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.

anti- CHAT antibody

FNab01631 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: choline acetyltransferase
  • Uniprot ID: P28329
  • Gene ID: 1103
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CHAT

anti- CHAT antibody

FNab01632 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:200
  • IF: 1:50-1:500
  • Immunogen: choline acetyltransferase
  • Uniprot ID: P28329
  • Gene ID: 1103
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CHAT

CHAT Blocking Peptide

20-abx062416
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CHAT Rabbit pAb

A12420-100ul 100 ul
EUR 308.00

CHAT Rabbit pAb

A12420-200ul 200 ul
EUR 459.00

CHAT Rabbit pAb

A12420-20ul 20 ul
EUR 183.00

CHAT Rabbit pAb

A12420-50ul 50 ul
EUR 223.00

CHAT Rabbit pAb

A13244-100ul 100 ul
EUR 308.00

CHAT Rabbit pAb

A13244-200ul 200 ul
EUR 459.00

CHAT Rabbit pAb

A13244-20ul 20 ul
EUR 183.00