RAB8A antibody

70R-10557 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB8A antibody

RAB8A antibody

70R-19724 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB8A antibody

RAB8A Antibody

36732-100ul 100ul
EUR 252.00

RAB8A Antibody

1-CSB-PA790236
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB8A. Recognizes RAB8A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:300

RAB8A Antibody

DF9836 200ul
EUR 304.00
Description: RAB8A Antibody detects endogenous levels of total RAB8A.

RAB8A Antibody

1-CSB-PA249917
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB8A. Recognizes RAB8A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB8A Antibody

1-CSB-PA295669
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB8A. Recognizes RAB8A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

RAB8A Antibody

1-CSB-PA019222GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB8A. Recognizes RAB8A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

RAB8A siRNA

20-abx904435
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB8A siRNA

20-abx930710
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB8A siRNA

20-abx930711
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB8A Antibody

ABD9836 100 ug
EUR 438.00

RAB8A Blocking Peptide

33R-3327 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB8A antibody, catalog no. 70R-10557

RAB8A Blocking Peptide

DF9836-BP 1mg
EUR 195.00

Polyclonal RAB8A Antibody

APR14385G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB8A . This antibody is tested and proven to work in the following applications:

RAB8A Conjugated Antibody

C36732 100ul
EUR 397.00

RAB8A cloning plasmid

CSB-CL019222HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggcgaagacctacgattacctgttcaagctgctgctgatcggggactcgggggtggggaagacctgtgtcctgttccgcttctccgaggacgccttcaactccacttttatctccaccataggaattgactttaaaattaggaccatagagctcgatggcaagagaattaaact
  • Show more
Description: A cloning plasmid for the RAB8A gene.

RAB8A Rabbit pAb

A3615-100ul 100 ul
EUR 308.00

RAB8A Rabbit pAb

A3615-200ul 200 ul
EUR 459.00

RAB8A Rabbit pAb

A3615-20ul 20 ul Ask for price

RAB8A Rabbit pAb

A3615-50ul 50 ul Ask for price

RAB8A Rabbit pAb

A2810-100ul 100 ul
EUR 308.00

RAB8A Rabbit pAb

A2810-200ul 200 ul
EUR 459.00

RAB8A Rabbit pAb

A2810-20ul 20 ul Ask for price

RAB8A Rabbit pAb

A2810-50ul 50 ul
EUR 223.00

RAB8A Rabbit pAb

A17369-100ul 100 ul
EUR 308.00

RAB8A Rabbit pAb

A17369-200ul 200 ul
EUR 459.00

RAB8A Rabbit pAb

A17369-20ul 20 ul
EUR 183.00

RAB8A Rabbit pAb

A17369-50ul 50 ul
EUR 223.00

RAB8A Polyclonal Antibody

ABP60071-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB8A protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB8A from Human, Mouse, Rat. This RAB8A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB8A protein at amino acid sequence of 120-200

RAB8A Polyclonal Antibody

ABP60071-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB8A protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB8A from Human, Mouse, Rat. This RAB8A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB8A protein at amino acid sequence of 120-200

RAB8A Polyclonal Antibody

ABP60071-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB8A protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB8A from Human, Mouse, Rat. This RAB8A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB8A protein at amino acid sequence of 120-200

anti- RAB8A antibody

FNab07045 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IF: 1:10-1:100
  • Immunogen: RAB8A, member RAS oncogene family
  • Uniprot ID: P61006
  • Gene ID: 4218
  • Research Area: Signal Transduction
Description: Antibody raised against RAB8A

RAB8A Polyclonal Antibody

ES10133-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB8A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB8A Polyclonal Antibody

ES10133-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB8A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB8A Antibody

PA2280 100ug/vial
EUR 334.00

Anti-RAB8A antibody

PAab07045 100 ug
EUR 355.00

EGFP- Rab8a- QL

PVT10345 2 ug
EUR 266.00

Anti-RAB8A antibody

STJ25268 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1.

Anti-RAB8A antibody

STJ25269 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1.

Anti-RAB8A antibody

STJ119495 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1.

Anti-RAB8A antibody

STJ71450 100 µg
EUR 359.00

Anti-RAB8A antibody

STJ191291 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB8A

Anti-RAB8A (3G1)

YF-MA10569 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB8A

Human RAB8A ELISA Kit

ELA-E14470h 96 Tests
EUR 824.00

RAB8A ELISA KIT|Human

EF005767 96 Tests
EUR 689.00

Rat RAB8A shRNA Plasmid

20-abx987411
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human RAB8A shRNA Plasmid

20-abx952869
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse RAB8A shRNA Plasmid

20-abx971488
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Canine RAB8A ELISA KIT

ELI-36826d 96 Tests
EUR 928.00

RAB8A Recombinant Protein (Human)

RP085929 100 ug Ask for price

RAB8A Recombinant Protein (Mouse)

RP166376 100 ug Ask for price

RAB8A Recombinant Protein (Rat)

RP223394 100 ug Ask for price

Polyclonal Goat Anti-RAB8A Antibody

APR16371G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAB8A . This antibody is tested and proven to work in the following applications:

Monoclonal RAB8A Antibody, Clone: 261CT1.3.1

AMM07495G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human RAB8A. The antibodies are raised in Mouse and are from clone 261CT1.3.1. This antibody is applicable in WB, E

Polyclonal RAB8A antibody - middle region

AMM07496G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB8A - middle region. This antibody is tested and proven to work in the following applications:

Rab8a ORF Vector (Rat) (pORF)

ORF074466 1.0 ug DNA
EUR 506.00

RAB8A ORF Vector (Human) (pORF)

ORF028644 1.0 ug DNA
EUR 405.00

Rab8a ORF Vector (Mouse) (pORF)

ORF055460 1.0 ug DNA
EUR 506.00

RAB8A ELISA Kit (Mouse) (OKEH05489)

OKEH05489 96 Wells
EUR 779.00
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in polarized vesicular trafficking and neurotransmitter release. Together with RAB11A, RAB3IP, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. Together with MYO5B and RAB11A participates in epithelial cell polarization. Plays an important role in ciliogenesis. Together with MICALL2, may also regulate adherens junction assembly. May play a role in insulin-induced transport to the plasma membrane of the glucose transporter GLUT4 and therefore play a role in glucose homeostasis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL

RAB8A ELISA Kit (Chicken) (OKEH06647)

OKEH06647 96 Wells
EUR 844.00
Description: Description of target: May be involved in vesicular trafficking and neurotransmitter release.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL

RAB8A ELISA Kit (Bovine) (OKEH08029)

OKEH08029 96 Wells
EUR 1092.00
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RAB8A ELISA Kit (Dog) (OKEH08030)

OKEH08030 96 Wells
EUR 1184.00
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Rab8A, Member Ras Oncogene Family Antibody

20-abx115002
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Polyclonal RAB8A / RAB8 Antibody (C-Terminus)

AMM07493G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RAB8A / RAB8 (C-Terminus). This antibody is tested and proven to work in the following applications:

Rab8a sgRNA CRISPR Lentivector set (Rat)

K7112101 3 x 1.0 ug
EUR 339.00

Rab8a sgRNA CRISPR Lentivector set (Mouse)

K3728801 3 x 1.0 ug
EUR 339.00

RAB8A sgRNA CRISPR Lentivector set (Human)

K1770301 3 x 1.0 ug
EUR 339.00

Human Ras-related protein Rab-8A (RAB8A)

1-CSB-EP019222HU(F1)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 37.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-8A(RAB8A),partial expressed in E.coli

Ras-Related Protein Rab-8A (RAB8A) Antibody

20-abx007263
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Ras-related protein Rab-8A (RAB8A) Antibody

20-abx214235
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-8A (RAB8A) Antibody

abx034177-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-8A (RAB8A) Antibody

abx034177-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Ras-related protein Rab-8A (RAB8A) Antibody

20-abx241992
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ras-related protein Rab-8A (RAB8A) Antibody

20-abx242379
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Monoclonal RAB8A Antibody (monoclonal) (M02), Clone: 3G1

APR14386G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human RAB8A (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G1. This antibody is applicable in WB, E

Ras-Related Protein Rab-8A (RAB8A) Antibody

abx412027-01mg 0.1 mg
EUR 704.00
  • Shipped within 1 week.

Ras-Related Protein Rab-8A (RAB8A) Antibody

abx237045-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Ras-Related Protein Rab-8A (RAB8A) Antibody

abx433208-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Ras-Related Protein Rab-8A (RAB8A) Antibody

20-abx002610
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Rab8a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7112102 1.0 ug DNA
EUR 154.00

Rab8a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7112103 1.0 ug DNA
EUR 154.00

Rab8a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7112104 1.0 ug DNA
EUR 154.00

Rab8a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3728802 1.0 ug DNA
EUR 154.00

Rab8a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3728803 1.0 ug DNA
EUR 154.00