CHCHD3 siRNA

20-abx911648
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CHCHD3 antibody

70R-4355 50 ug
EUR 467.00
Description: Rabbit polyclonal CHCHD3 antibody raised against the N terminal of CHCHD3

CHCHD3 antibody

70R-4356 50 ug
EUR 467.00
Description: Rabbit polyclonal CHCHD3 antibody raised against the middle region of CHCHD3

CHCHD3 Antibody

46485-100ul 100ul
EUR 252.00

CHCHD3 Antibody

1-CSB-PA873679ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CHCHD3. Recognizes CHCHD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CHCHD3 Antibody

1-CSB-PA873679ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CHCHD3. Recognizes CHCHD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CHCHD3 Antibody

DF12254 200ul
EUR 304.00
Description: CHCHD3 antibody detects endogenous levels of CHCHD3.

anti-CHCHD3

YF-PA19450 50 ug
EUR 363.00
Description: Mouse polyclonal to CHCHD3

CHCHD3 Conjugated Antibody

C46485 100ul
EUR 397.00

anti- CHCHD3 antibody

FNab01636 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: coiled-coil-helix-coiled-coil-helix domain containing 3
  • Uniprot ID: Q9NX63
  • Gene ID: 54927
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CHCHD3

CHCHD3 Rabbit pAb

A8584-100ul 100 ul
EUR 308.00

CHCHD3 Rabbit pAb

A8584-200ul 200 ul
EUR 459.00

CHCHD3 Rabbit pAb

A8584-20ul 20 ul
EUR 183.00

CHCHD3 Rabbit pAb

A8584-50ul 50 ul
EUR 223.00

CHCHD3 Blocking Peptide

33R-5354 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHCHD3 antibody, catalog no. 70R-4356

CHCHD3 Blocking Peptide

33R-8063 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHCHD3 antibody, catalog no. 70R-4355

CHCHD3 cloning plasmid

CSB-CL873679HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgggtgggaccaccagcacccgccgggtcaccttcgaggcggacgagaatgagaacatcaccgtggtgaagggcatccggctttcggaaaatgtgattgatcgaatgaaggaatcctctccatctggttcgaagtctcagcggtattctggtgcttatggtgcctcagtttctga
  • Show more
Description: A cloning plasmid for the CHCHD3 gene.

CHCHD3 Blocking Peptide

DF12254-BP 1mg
EUR 195.00

Anti-CHCHD3 antibody

PAab01636 100 ug
EUR 386.00

pCMV-SPORT6-CHCHD3

PVT13709 2 ug
EUR 391.00

Anti-CHCHD3 antibody

STJ72148 100 µg
EUR 359.00

Anti-CHCHD3 antibody

STJ11100835 100 µl
EUR 413.00
Description: The protein encoded by this gene is an inner mitochondrial membrane scaffold protein. Absence of the encoded protein affects the structural integrity of mitochondrial cristae and leads to reductions in ATP production, cell growth, and oxygen consumption. This protein is part of the mitochondrial contact site and cristae organizing system (MICOS). Several transcript variants encoding different isoforms have been found for this gene.

Anti-CHCHD3 antibody

STJ111317 100 µl
EUR 277.00
Description: The protein encoded by this gene is an inner mitochondrial membrane scaffold protein. Absence of the encoded protein affects the structural integrity of mitochondrial cristae and leads to reductions in ATP production, cell growth, and oxygen consumption. This protein is part of the mitochondrial contact site and cristae organizing system (MICOS). Several transcript variants encoding different isoforms have been found for this gene.

Polyclonal CHCHD3 Antibody (Center)

APG02568G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHCHD3 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CHCHD3 Antibody (Internal)

APG02570G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHCHD3 (Internal). This antibody is tested and proven to work in the following applications:

Mouse CHCHD3 shRNA Plasmid

20-abx975382
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CHCHD3 ELISA KIT

ELI-10146h 96 Tests
EUR 824.00

Mouse Chchd3 ELISA KIT

ELI-10573m 96 Tests
EUR 865.00

CHCHD3 ELISA KIT|Human

EF008626 96 Tests
EUR 689.00

Bovine CHCHD3 ELISA KIT

ELI-50073b 96 Tests
EUR 928.00

CHCHD3 protein (His tag)

80R-3511 20 ug
EUR 327.00
Description: Purified recombinant CHCHD3 protein (His tag)

Human CHCHD3 shRNA Plasmid

20-abx960329
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CHCHD3 Recombinant Protein (Human)

RP006955 100 ug Ask for price

CHCHD3 Recombinant Protein (Rat)

RP194780 100 ug Ask for price

CHCHD3 Recombinant Protein (Mouse)

RP123815 100 ug Ask for price

Polyclonal CHCHD3 Antibody (internal region)

APG02569G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHCHD3 (internal region). This antibody is tested and proven to work in the following applications:

[KO Validated] CHCHD3 Rabbit pAb

A19959-100ul 100 ul
EUR 410.00

[KO Validated] CHCHD3 Rabbit pAb

A19959-200ul 200 ul
EUR 571.00

[KO Validated] CHCHD3 Rabbit pAb

A19959-20ul 20 ul
EUR 221.00

[KO Validated] CHCHD3 Rabbit pAb

A19959-50ul 50 ul
EUR 287.00

CHCHD3 ORF Vector (Human) (pORF)

ORF002319 1.0 ug DNA
EUR 95.00

Chchd3 ORF Vector (Mouse) (pORF)

ORF041273 1.0 ug DNA
EUR 506.00

Chchd3 ORF Vector (Rat) (pORF)

ORF064928 1.0 ug DNA
EUR 506.00

[One Step] CHCHD3 Antibody Kit

RK05633 50 ul
EUR 240.00

Anti-CHCHD3 (aa151-164) antibody

STJ72149 100 µg
EUR 359.00

CHCHD3 sgRNA CRISPR Lentivector set (Human)

K0441801 3 x 1.0 ug
EUR 339.00

Chchd3 sgRNA CRISPR Lentivector set (Mouse)

K4677901 3 x 1.0 ug
EUR 339.00

Chchd3 sgRNA CRISPR Lentivector set (Rat)

K6143501 3 x 1.0 ug
EUR 339.00

Human MICOS complex subunit MIC19 (CHCHD3)

1-CSB-EP873679HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 53.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human MICOS complex subunit MIC19(CHCHD3) expressed in E.coli

Polyclonal CHCHD3 (aa151-164) Antibody (internal region)

APG02567G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHCHD3 (aa151-164) (internal region). This antibody is tested and proven to work in the following applications:

CHCHD3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0441802 1.0 ug DNA
EUR 154.00

CHCHD3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0441803 1.0 ug DNA
EUR 154.00

CHCHD3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0441804 1.0 ug DNA
EUR 154.00

Chchd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4677902 1.0 ug DNA
EUR 154.00

Chchd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4677903 1.0 ug DNA
EUR 154.00

Chchd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4677904 1.0 ug DNA
EUR 154.00

Chchd3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6143502 1.0 ug DNA
EUR 154.00

Chchd3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6143503 1.0 ug DNA
EUR 154.00

Chchd3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6143504 1.0 ug DNA
EUR 154.00

CHCHD3 Protein Vector (Human) (pPB-C-His)

PV009273 500 ng
EUR 329.00

CHCHD3 Protein Vector (Human) (pPB-N-His)

PV009274 500 ng
EUR 329.00

CHCHD3 Protein Vector (Human) (pPM-C-HA)

PV009275 500 ng
EUR 329.00

CHCHD3 Protein Vector (Human) (pPM-C-His)

PV009276 500 ng
EUR 329.00

CHCHD3 Protein Vector (Rat) (pPB-C-His)

PV259710 500 ng
EUR 603.00

CHCHD3 Protein Vector (Rat) (pPB-N-His)

PV259711 500 ng
EUR 603.00

CHCHD3 Protein Vector (Rat) (pPM-C-HA)

PV259712 500 ng
EUR 603.00

CHCHD3 Protein Vector (Rat) (pPM-C-His)

PV259713 500 ng
EUR 603.00

CHCHD3 Protein Vector (Mouse) (pPB-C-His)

PV165090 500 ng
EUR 603.00

CHCHD3 Protein Vector (Mouse) (pPB-N-His)

PV165091 500 ng
EUR 603.00

CHCHD3 Protein Vector (Mouse) (pPM-C-HA)

PV165092 500 ng
EUR 603.00

CHCHD3 Protein Vector (Mouse) (pPM-C-His)

PV165093 500 ng
EUR 603.00

Chchd3 3'UTR Luciferase Stable Cell Line

TU202259 1.0 ml Ask for price

Chchd3 3'UTR GFP Stable Cell Line

TU153806 1.0 ml Ask for price

CHCHD3 3'UTR Luciferase Stable Cell Line

TU004319 1.0 ml
EUR 1394.00

Chchd3 3'UTR Luciferase Stable Cell Line

TU103806 1.0 ml Ask for price

CHCHD3 3'UTR GFP Stable Cell Line

TU054319 1.0 ml
EUR 1394.00

Chchd3 3'UTR GFP Stable Cell Line

TU252259 1.0 ml Ask for price

CHCHD3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791329 1.0 ug DNA
EUR 316.00

CHCHD3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791330 1.0 ug DNA
EUR 316.00

CHCHD3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0441805 3 x 1.0 ug
EUR 376.00

Chchd3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4677905 3 x 1.0 ug
EUR 376.00

Chchd3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6143505 3 x 1.0 ug
EUR 376.00

CHCHD3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0441806 1.0 ug DNA
EUR 167.00

CHCHD3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0441807 1.0 ug DNA
EUR 167.00

CHCHD3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0441808 1.0 ug DNA
EUR 167.00

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody

20-abx123560
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody

20-abx322584
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody

20-abx322585
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody

abx340011-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody

abx431889-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.