CHCHD3 Antibody
1-CSB-PA873679ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CHCHD3. Recognizes CHCHD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CHCHD3 Antibody
1-CSB-PA873679ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CHCHD3. Recognizes CHCHD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CHCHD3 Antibody
DF12254	Affbiotech	200ul	EUR 304
Description: CHCHD3 antibody detects endogenous levels of CHCHD3.

CHCHD3 antibody
70R-4355	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CHCHD3 antibody raised against the N terminal of CHCHD3

CHCHD3 antibody
70R-4356	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CHCHD3 antibody raised against the middle region of CHCHD3

CHCHD3 siRNA
20-abx911647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHCHD3 siRNA
20-abx911648	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CHCHD3
YF-PA19450	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CHCHD3

CHCHD3 Blocking Peptide
33R-5354	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHCHD3 antibody, catalog no. 70R-4356

CHCHD3 Blocking Peptide
33R-8063	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHCHD3 antibody, catalog no. 70R-4355

CHCHD3 Blocking Peptide
DF12254-BP	Affbiotech	1mg	EUR 195

CHCHD3 Conjugated Antibody
C46485	SAB	100ul	EUR 397

CHCHD3 cloning plasmid
CSB-CL873679HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 684 Sequence: atgggtgggaccaccagcacccgccgggtcaccttcgaggcggacgagaatgagaacatcaccgtggtgaagggcatccggctttcggaaaatgtgattgatcgaatgaaggaatcctctccatctggttcgaagtctcagcggtattctggtgcttatggtgcctcagtttctga Show more
Description: A cloning plasmid for the CHCHD3 gene.

CHCHD3 Rabbit pAb
A8584-100ul	Abclonal	100 ul	EUR 308

CHCHD3 Rabbit pAb
A8584-200ul	Abclonal	200 ul	EUR 459

CHCHD3 Rabbit pAb
A8584-20ul	Abclonal	20 ul	EUR 183

CHCHD3 Rabbit pAb
A8584-50ul	Abclonal	50 ul	EUR 223

anti- CHCHD3 antibody
FNab01636	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: coiled-coil-helix-coiled-coil-helix domain containing 3 Uniprot ID: Q9NX63 Gene ID: 54927 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CHCHD3

Anti-CHCHD3 antibody
PAab01636	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-CHCHD3
PVT13709	Lifescience Market	2 ug	EUR 391

Anti-CHCHD3 antibody
STJ11100835	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is an inner mitochondrial membrane scaffold protein. Absence of the encoded protein affects the structural integrity of mitochondrial cristae and leads to reductions in ATP production, cell growth, and oxygen consumption. This protein is part of the mitochondrial contact site and cristae organizing system (MICOS). Several transcript variants encoding different isoforms have been found for this gene.

Anti-CHCHD3 antibody
STJ111317	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is an inner mitochondrial membrane scaffold protein. Absence of the encoded protein affects the structural integrity of mitochondrial cristae and leads to reductions in ATP production, cell growth, and oxygen consumption. This protein is part of the mitochondrial contact site and cristae organizing system (MICOS). Several transcript variants encoding different isoforms have been found for this gene.

Anti-CHCHD3 antibody
STJ72148	St John's Laboratory	100 µg	EUR 359

CHCHD3 protein (His tag)
80R-3511	Fitzgerald	20 ug	EUR 327
Description: Purified recombinant CHCHD3 protein (His tag)

Human CHCHD3 ELISA KIT
ELI-10146h	Lifescience Market	96 Tests	EUR 824

Mouse Chchd3 ELISA KIT
ELI-10573m	Lifescience Market	96 Tests	EUR 865

CHCHD3 ELISA KIT|Human
EF008626	Lifescience Market	96 Tests	EUR 689

Polyclonal CHCHD3 Antibody (Center)
APG02568G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHCHD3 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CHCHD3 Antibody (Internal)
APG02570G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHCHD3 (Internal). This antibody is tested and proven to work in the following applications:

Mouse CHCHD3 shRNA Plasmid
20-abx975382	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CHCHD3 shRNA Plasmid
20-abx960329	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine CHCHD3 ELISA KIT
ELI-50073b	Lifescience Market	96 Tests	EUR 928

CHCHD3 Recombinant Protein (Human)
RP006955	ABM	100 ug	Ask for price

CHCHD3 Recombinant Protein (Rat)
RP194780	ABM	100 ug	Ask for price

CHCHD3 Recombinant Protein (Mouse)
RP123815	ABM	100 ug	Ask for price

Polyclonal CHCHD3 Antibody (internal region)
APG02569G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHCHD3 (internal region). This antibody is tested and proven to work in the following applications:

[KO Validated] CHCHD3 Rabbit pAb
A19959-100ul	Abclonal	100 ul	EUR 410

[KO Validated] CHCHD3 Rabbit pAb
A19959-200ul	Abclonal	200 ul	EUR 571

[KO Validated] CHCHD3 Rabbit pAb
A19959-20ul	Abclonal	20 ul	EUR 221

[KO Validated] CHCHD3 Rabbit pAb
A19959-50ul	Abclonal	50 ul	EUR 287

Chchd3 ORF Vector (Rat) (pORF)
ORF064928	ABM	1.0 ug DNA	EUR 506

CHCHD3 ORF Vector (Human) (pORF)
ORF002319	ABM	1.0 ug DNA	EUR 95

Chchd3 ORF Vector (Mouse) (pORF)
ORF041273	ABM	1.0 ug DNA	EUR 506

[One Step] CHCHD3 Antibody Kit
RK05633	Abclonal	50 ul	EUR 240

Anti-CHCHD3 (aa151-164) antibody
STJ72149	St John's Laboratory	100 µg	EUR 359

Human MICOS complex subunit MIC19 (CHCHD3)
1-CSB-EP873679HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human MICOS complex subunit MIC19(CHCHD3) expressed in E.coli

CHCHD3 sgRNA CRISPR Lentivector set (Human)
K0441801	ABM	3 x 1.0 ug	EUR 339

Chchd3 sgRNA CRISPR Lentivector set (Rat)
K6143501	ABM	3 x 1.0 ug	EUR 339

Chchd3 sgRNA CRISPR Lentivector set (Mouse)
K4677901	ABM	3 x 1.0 ug	EUR 339

Polyclonal CHCHD3 (aa151-164) Antibody (internal region)
APG02567G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHCHD3 (aa151-164) (internal region). This antibody is tested and proven to work in the following applications:

CHCHD3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0441802	ABM	1.0 ug DNA	EUR 154

CHCHD3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0441803	ABM	1.0 ug DNA	EUR 154

CHCHD3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0441804	ABM	1.0 ug DNA	EUR 154

Chchd3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6143502	ABM	1.0 ug DNA	EUR 154

Chchd3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6143503	ABM	1.0 ug DNA	EUR 154

Chchd3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6143504	ABM	1.0 ug DNA	EUR 154

Chchd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4677902	ABM	1.0 ug DNA	EUR 154

Chchd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4677903	ABM	1.0 ug DNA	EUR 154

Chchd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4677904	ABM	1.0 ug DNA	EUR 154

CHCHD3 Protein Vector (Mouse) (pPB-C-His)
PV165090	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Mouse) (pPB-N-His)
PV165091	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Mouse) (pPM-C-HA)
PV165092	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Mouse) (pPM-C-His)
PV165093	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Rat) (pPB-C-His)
PV259710	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Rat) (pPB-N-His)
PV259711	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Rat) (pPM-C-HA)
PV259712	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Rat) (pPM-C-His)
PV259713	ABM	500 ng	EUR 603

CHCHD3 Protein Vector (Human) (pPB-C-His)
PV009273	ABM	500 ng	EUR 329

CHCHD3 Protein Vector (Human) (pPB-N-His)
PV009274	ABM	500 ng	EUR 329

CHCHD3 Protein Vector (Human) (pPM-C-HA)
PV009275	ABM	500 ng	EUR 329

CHCHD3 Protein Vector (Human) (pPM-C-His)
PV009276	ABM	500 ng	EUR 329

Chchd3 3'UTR GFP Stable Cell Line
TU153806	ABM	1.0 ml	Ask for price

Chchd3 3'UTR Luciferase Stable Cell Line
TU103806	ABM	1.0 ml	Ask for price

Chchd3 3'UTR Luciferase Stable Cell Line
TU202259	ABM	1.0 ml	Ask for price

Chchd3 3'UTR GFP Stable Cell Line
TU252259	ABM	1.0 ml	Ask for price

CHCHD3 3'UTR GFP Stable Cell Line
TU054319	ABM	1.0 ml	EUR 1394

CHCHD3 3'UTR Luciferase Stable Cell Line
TU004319	ABM	1.0 ml	EUR 1394

CHCHD3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV791329	ABM	1.0 ug DNA	EUR 316

CHCHD3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV791330	ABM	1.0 ug DNA	EUR 316

CHCHD3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0441805	ABM	3 x 1.0 ug	EUR 376

Chchd3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6143505	ABM	3 x 1.0 ug	EUR 376

Chchd3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4677905	ABM	3 x 1.0 ug	EUR 376

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
20-abx123560	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
abx340011-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
20-abx322584	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
20-abx322585	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
abx431889-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
abx432065-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 3 (CHCHD3) Antibody
abx231636-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

CHCHD3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0441806	ABM	1.0 ug DNA	EUR 167