Human Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Hu-96T 96T
EUR 673.00
  • Should the Human Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Mouse Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Mu-48T 48T
EUR 527.00
  • Should the Mouse Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Mouse Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Mu-96T 96T
EUR 688.00
  • Should the Mouse Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Human Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Hu-48Tests 48 Tests
EUR 544.00

Human Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Hu-96Tests 96 Tests
EUR 756.00

Mouse Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Mu-48Tests 48 Tests
EUR 557.00

Mouse Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Mu-96Tests 96 Tests
EUR 774.00

Human Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Hu-48Tests 48 Tests
EUR 521.00

Human Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Hu-96Tests 96 Tests
EUR 723.00

Mouse Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Mu-48Tests 48 Tests
EUR 533.00

Mouse Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Mu-96Tests 96 Tests
EUR 740.00

LMNA Antibody

32042-100ul 100ul
EUR 252.00

LMNA Antibody

1-CSB-PA003130
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

LMNA Antibody

1-CSB-PA003131
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

LMNA Antibody

1-CSB-PA144058
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

LMNA Antibody

DF6052 200ul
EUR 304.00
Description: LMNA Antibody detects endogenous levels of total LMNA.

LMNA Antibody

1-CSB-PA193640
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

LMNA Antibody

1-CSB-PA013003GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

LMNA Antibody

1-CSB-PA013003HA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200

LMNA siRNA

20-abx903004
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LMNA siRNA

20-abx922680
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LMNA siRNA

20-abx922681
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LMNA Antibody

ABD6052 100 ug
EUR 438.00

pOTB7-LMNA

PVT18459 2 ug
EUR 231.00

LMNA Blocking Peptide

DF6052-BP 1mg
EUR 195.00

LMNA Conjugated Antibody

C32042 100ul
EUR 397.00

LMNA cloning plasmid

CSB-CL013003HU1-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atggagaccccgtcccagcggcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggc
  • Show more
Description: A cloning plasmid for the LMNA gene.

LMNA cloning plasmid

CSB-CL013003HU2-10ug 10ug
EUR 668.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1995
  • Sequence: atggagaccccgtcccagcggcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggc
  • Show more
Description: A cloning plasmid for the LMNA gene.

anti-LMNA (4E7)

LF-MA30610 100 ul
EUR 527.00
Description: Mouse Monoclonal to LMNA

Recombinant human LMNA

P1083 100ug Ask for price
  • Uniprot ID: P02545-2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LMNA

Anti-LMNA antibody

STJ110962 100 µl
EUR 277.00
Description: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome.

Anti-LMNA antibody

STJ24412 100 µl
EUR 277.00
Description: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome.

Anti-LMNA antibody

STJ140138 150 µg
EUR 408.00
Description: Goat polyclonal to LMNA (Lamin A/C) - nucleus marker. The Lamin family of proteins make up the matrix of proteins located next to the inner nuclear membrane. During mitosis, the lamina matrix is reversibly disassembled as the Lamin proteins are phosphorylated. These proteins are thought to be involved in chromatin structure, nuclear stability and gene expression.

Cleaved-LMNA (D230) Antibody

1-CSB-PA000047
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-LMNA (D230). Recognizes Cleaved-LMNA (D230) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Polyclonal LMNA Antibody (Center)

APR04303G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LMNA (Center). This antibody is tested and proven to work in the following applications:

Lamin A (LMNA) Antibody

abx015912-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx119039
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx125051
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx126963
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx030198-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx030198-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

LMNA ELISA KIT|Human

EF001125 96 Tests
EUR 689.00

Rat LMNA shRNA Plasmid

20-abx986027
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

LMNA Antibody, HRP conjugated

1-CSB-PA013003HB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LMNA Antibody, FITC conjugated

1-CSB-PA013003HC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LMNA Antibody, Biotin conjugated

1-CSB-PA013003HD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cleaved-LMNA (N231) Antibody

1-CSB-PA009843
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-LMNA (N231). Recognizes Cleaved-LMNA (N231) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Phospho-LMNA (S22) Antibody

1-CSB-PA009844
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-LMNA (S22). Recognizes Phospho-LMNA (S22) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Phospho-LMNA (S392) Antibody

1-CSB-PA009845
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-LMNA (S392). Recognizes Phospho-LMNA (S392) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Lamin A (LMNA) Antibody

abx413067-01mg 0.1 mg
EUR 634.00
  • Shipped within 1 week.

Human LMNA shRNA Plasmid

20-abx952708
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse LMNA shRNA Plasmid

20-abx971331
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Lamin A (LMNA) Antibody

20-abx000634
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

LMNA Recombinant Protein (Human)

RP017893 100 ug Ask for price

LMNA Recombinant Protein (Human)

RP017896 100 ug Ask for price

LMNA Recombinant Protein (Rat)

RP208334 100 ug Ask for price

LMNA Recombinant Protein (Mouse)

RP147701 100 ug Ask for price

LMNA Recombinant Protein (Mouse)

RP147704 100 ug Ask for price

LMNA Recombinant Protein (Mouse)

RP147707 100 ug Ask for price

Phospho-LMNA-S22 Rabbit pAb

AP0777-100ul 100 ul
EUR 384.00

Phospho-LMNA-S22 Rabbit pAb

AP0777-200ul 200 ul
EUR 554.00

Phospho-LMNA-S22 Rabbit pAb

AP0777-20ul 20 ul
EUR 183.00

Phospho-LMNA-S22 Rabbit pAb

AP0777-50ul 50 ul
EUR 265.00

Lamin A/C (LMNA) Antibody

20-abx009031
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx009032
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx009033
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx214980
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx177302
  • EUR 1233.00
  • EUR 592.00
  • 0
  • 1
  • Please enquire.

Lamin A/C (LMNA) Antibody

20-abx177303
  • EUR 1233.00
  • EUR 592.00
  • 0
  • 1
  • Please enquire.

Lamin A/C (LMNA) Antibody

20-abx177304
  • EUR 1302.00
  • EUR 620.00
  • 0
  • 1
  • Please enquire.

Lamin A/C (LMNA) Antibody

20-abx113432
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx129142
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Lamin A/C (LMNA) Antibody

20-abx132239
  • EUR 328.00
  • EUR 829.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Lamin A/C (LMNA) Antibody

20-abx132258
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Lamin A/C (LMNA) Antibody

20-abx133069
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx173298
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Lamin A/C (LMNA) Antibody

20-abx173299
  • EUR 913.00
  • EUR 467.00
  • 0
  • 1
  • Please enquire.

Lamin A/C (LMNA) Antibody

20-abx270128
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Lamin A/C (LMNA) Antibody

20-abx241809
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

abx234681-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Lamin A/C (LMNA) Antibody

20-abx329327
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx328255
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx328386
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx328850
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Monoclonal LMNA Antibody, Clone: 4E7

AMM02857G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human LMNA. The antibodies are raised in Mouse and are from clone 4E7. This antibody is applicable in WB and IHC, E

Lmna ORF Vector (Rat) (pORF)

ORF069446 1.0 ug DNA
EUR 506.00

h LMNA inducible lentiviral particles

LVP174 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, LMNA, is fully sequence verified and matched to NCBI accession ID: NM_005572.3

LMNA ORF Vector (Human) (pORF)

ORF005965 1.0 ug DNA
EUR 95.00

LMNA ORF Vector (Human) (pORF)

ORF005966 1.0 ug DNA
EUR 95.00

Lmna ORF Vector (Mouse) (pORF)

ORF049235 1.0 ug DNA
EUR 506.00

Lmna ORF Vector (Mouse) (pORF)

ORF049236 1.0 ug DNA
EUR 506.00

Lmna ORF Vector (Mouse) (pORF)

ORF049237 1.0 ug DNA
EUR 506.00

Recombinant Lamin A/C (LMNA)

4-RPF550Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P02545
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 52.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Lamin A/C expressed in: E.coli

pLVX-Puro-Flag-LMNA Plasmid

PVTB00533-4a 2 ug
EUR 356.00

pECMV-Lmna-m-FLAG Plasmid

PVT15684 2 ug
EUR 325.00