TRAPPC9 Antibody
1-CSB-PA842741LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
TRAPPC9 Antibody
DF12489 200ul
EUR 304.00
Description: TRAPPC9 antibody detects endogenous levels of TRAPPC9.
TRAPPC9 Antibody
1-CSB-PA024234GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TRAPPC9 siRNA
20-abx937966
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TRAPPC9 siRNA
20-abx937967
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TRAPPC9 Polyclonal Antibody
29323-100ul 100ul
EUR 252.00
TRAPPC9 Polyclonal Antibody
29323-50ul 50ul
EUR 187.00
TRAPPC9 Rabbit pAb
A15527-100ul 100 ul
EUR 308.00
TRAPPC9 Rabbit pAb
A15527-200ul 200 ul
EUR 459.00
TRAPPC9 Rabbit pAb
A15527-20ul 20 ul
EUR 183.00
TRAPPC9 Rabbit pAb
A15527-50ul 50 ul
EUR 223.00
TRAPPC9 Blocking Peptide
DF12489-BP 1mg
EUR 195.00
TRAPPC9 cloning plasmid
CSB-CL842741HU-10ug 10ug
EUR 877.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2739
  • Sequence: atgtcggtggagctgctgcgttctgtgaatgactttctgtggcttggagctgccctggaaggattgtgttcagcttctgtcatctatcactatcctggtggaactggtgggaagagtggagctcggaggttccagggcagcacccttcctgctgaagcagccaatagacaccggc
  • Show more
Description: A cloning plasmid for the TRAPPC9 gene.
Anti-TRAPPC9 antibody
PAab08949 100 ug
EUR 355.00
Anti-TRAPPC9 antibody
STJ117722 100 µl
EUR 277.00
Description: This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.
TRAPPC9 Antibody, HRP conjugated
1-CSB-PA842741LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TRAPPC9 Antibody, FITC conjugated
1-CSB-PA842741LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TRAPPC9 Antibody, Biotin conjugated
1-CSB-PA842741LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human TRAPPC9 ELISA KIT
ELI-16494h 96 Tests
EUR 824.00
TRAPPC9 ELISA KIT|Human
EF003802 96 Tests
EUR 689.00
Bovine TRAPPC9 ELISA KIT
ELI-51135b 96 Tests
EUR 928.00
Mouse TRAPPC9 shRNA Plasmid
20-abx978632
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TRAPPC9 Polyclonal Conjugated Antibody
C29323 100ul
EUR 397.00
Human TRAPPC9 shRNA Plasmid
20-abx963166
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
anti- Trappc9,NIBP antibody
FNab08950 100µg
EUR 548.75
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against Trappc9,NIBP
anti- Trappc9,NIBP antibody
FNab08951 100µg
EUR 585.00
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against Trappc9,NIBP
anti- TRAPPC9,NIBP antibody
FNab08952 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against TRAPPC9,NIBP
anti- TRAPPC9/NIBP antibody
FNab08953 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against TRAPPC9/NIBP
Mouse Trappc9 ELISA KIT
ELI-36677m 96 Tests
EUR 865.00
Anti-Trappc9,NIBP antibody
PAab08950 100 ug
EUR 386.00
Anti-Trappc9,NIBP antibody
PAab08951 100 ug
EUR 412.00
Anti-TRAPPC9/NIBP antibody
PAab08953 100 ug
EUR 386.00
Trappc9/NIBP ELISA KIT|Human
EF003803 96 Tests
EUR 689.00
Trappc9 ORF Vector (Rat) (pORF)
ORF078192 1.0 ug DNA
EUR 506.00
TRAPPC9 ORF Vector (Human) (pORF)
ORF034294 1.0 ug DNA Ask for price
Trappc9 ORF Vector (Mouse) (pORF)
ORF060313 1.0 ug DNA
EUR 506.00
Trappc9 ORF Vector (Mouse) (pORF)
ORF060314 1.0 ug DNA
EUR 506.00
Trappc9 ORF Vector (Mouse) (pORF)
ORF060315 1.0 ug DNA
EUR 506.00
Trappc9 ORF Vector (Mouse) (pORF)
ORF060316 1.0 ug DNA
EUR 506.00
Trappc9 ORF Vector (Mouse) (pORF)
ORF060317 1.0 ug DNA
EUR 506.00
Trappc9 sgRNA CRISPR Lentivector set (Rat)
K6652001 3 x 1.0 ug
EUR 339.00
Trappc9 sgRNA CRISPR Lentivector set (Mouse)
K4631901 3 x 1.0 ug
EUR 339.00
TRAPPC9 sgRNA CRISPR Lentivector set (Human)
K2442001 3 x 1.0 ug
EUR 339.00
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
20-abx116143
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
abx145294-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
abx238949-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
20-abx302200
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6652002 1.0 ug DNA
EUR 154.00
Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6652003 1.0 ug DNA
EUR 154.00
Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6652004 1.0 ug DNA
EUR 154.00
Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4631902 1.0 ug DNA
EUR 154.00
Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4631903 1.0 ug DNA
EUR 154.00
Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4631904 1.0 ug DNA
EUR 154.00
TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2442002 1.0 ug DNA
EUR 154.00
TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2442003 1.0 ug DNA
EUR 154.00
TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2442004 1.0 ug DNA
EUR 154.00
TRAPPC9 Protein Vector (Human) (pPB-C-His)
PV137174 500 ng Ask for price
TRAPPC9 Protein Vector (Human) (pPB-N-His)
PV137175 500 ng Ask for price
TRAPPC9 Protein Vector (Human) (pPM-C-HA)
PV137176 500 ng Ask for price
TRAPPC9 Protein Vector (Human) (pPM-C-His)
PV137177 500 ng Ask for price
TRAPPC9 Protein Vector (Rat) (pPB-C-His)
PV312766 500 ng
EUR 1191.00
TRAPPC9 Protein Vector (Rat) (pPB-N-His)
PV312767 500 ng
EUR 1191.00
TRAPPC9 Protein Vector (Rat) (pPM-C-HA)
PV312768 500 ng
EUR 1191.00
TRAPPC9 Protein Vector (Rat) (pPM-C-His)
PV312769 500 ng
EUR 1191.00
TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241250 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241251 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241252 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPM-C-His)
PV241253 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241254 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241255 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241256 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPM-C-His)
PV241257 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241258 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241259 500 ng
EUR 1065.00
TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241260 500 ng
EUR 1065.00