TRAPPC9

TRAPPC9 Antibody
1-CSB-PA842741LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TRAPPC9 Antibody
DF12489	Affbiotech	200ul	EUR 304
Description: TRAPPC9 antibody detects endogenous levels of TRAPPC9.

TRAPPC9 Antibody
1-CSB-PA024234GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TRAPPC9 siRNA
20-abx937966	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRAPPC9 siRNA
20-abx937967	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRAPPC9 Polyclonal Antibody
29323-100ul	SAB	100ul	EUR 252

TRAPPC9 Polyclonal Antibody
29323-50ul	SAB	50ul	EUR 187

TRAPPC9 Rabbit pAb
A15527-100ul	Abclonal	100 ul	EUR 308

TRAPPC9 Rabbit pAb
A15527-200ul	Abclonal	200 ul	EUR 459

TRAPPC9 Rabbit pAb
A15527-20ul	Abclonal	20 ul	EUR 183

TRAPPC9 Rabbit pAb
A15527-50ul	Abclonal	50 ul	EUR 223

TRAPPC9 Blocking Peptide
DF12489-BP	Affbiotech	1mg	EUR 195

TRAPPC9 cloning plasmid
CSB-CL842741HU-10ug	Cusabio	10ug	EUR 877
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2739 Sequence: atgtcggtggagctgctgcgttctgtgaatgactttctgtggcttggagctgccctggaaggattgtgttcagcttctgtcatctatcactatcctggtggaactggtgggaagagtggagctcggaggttccagggcagcacccttcctgctgaagcagccaatagacaccggc Show more
Description: A cloning plasmid for the TRAPPC9 gene.

Anti-TRAPPC9 antibody
PAab08949	Lifescience Market	100 ug	EUR 355

Anti-TRAPPC9 antibody
STJ117722	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.

TRAPPC9 Antibody, HRP conjugated
1-CSB-PA842741LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRAPPC9 Antibody, FITC conjugated
1-CSB-PA842741LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRAPPC9 Antibody, Biotin conjugated
1-CSB-PA842741LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TRAPPC9 ELISA KIT
ELI-16494h	Lifescience Market	96 Tests	EUR 824

TRAPPC9 ELISA KIT|Human
EF003802	Lifescience Market	96 Tests	EUR 689

Bovine TRAPPC9 ELISA KIT
ELI-51135b	Lifescience Market	96 Tests	EUR 928

Mouse TRAPPC9 shRNA Plasmid
20-abx978632	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRAPPC9 Polyclonal Conjugated Antibody
C29323	SAB	100ul	EUR 397

Human TRAPPC9 shRNA Plasmid
20-abx963166	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- Trappc9,NIBP antibody
FNab08950	FN Test	100µg	EUR 548.75
Immunogen: trafficking protein particle complex 9 Uniprot ID: Q96Q05 Gene ID: 83696 Research Area: Signal Transduction
Description: Antibody raised against Trappc9,NIBP

anti- Trappc9,NIBP antibody
FNab08951	FN Test	100µg	EUR 585
Immunogen: trafficking protein particle complex 9 Uniprot ID: Q96Q05 Gene ID: 83696 Research Area: Signal Transduction
Description: Antibody raised against Trappc9,NIBP

anti- TRAPPC9,NIBP antibody
FNab08952	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 Immunogen: trafficking protein particle complex 9 Uniprot ID: Q96Q05 Gene ID: 83696 Research Area: Signal Transduction
Description: Antibody raised against TRAPPC9,NIBP

anti- TRAPPC9/NIBP antibody
FNab08953	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IP: 1:200-1:2000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: trafficking protein particle complex 9 Uniprot ID: Q96Q05 Gene ID: 83696 Research Area: Signal Transduction
Description: Antibody raised against TRAPPC9/NIBP

Mouse Trappc9 ELISA KIT
ELI-36677m	Lifescience Market	96 Tests	EUR 865

Anti-Trappc9,NIBP antibody
PAab08950	Lifescience Market	100 ug	EUR 386

Anti-Trappc9,NIBP antibody
PAab08951	Lifescience Market	100 ug	EUR 412

Anti-TRAPPC9/NIBP antibody
PAab08953	Lifescience Market	100 ug	EUR 386

Trappc9/NIBP ELISA KIT|Human
EF003803	Lifescience Market	96 Tests	EUR 689

Trappc9 ORF Vector (Rat) (pORF)
ORF078192	ABM	1.0 ug DNA	EUR 506

TRAPPC9 ORF Vector (Human) (pORF)
ORF034294	ABM	1.0 ug DNA	Ask for price

Trappc9 ORF Vector (Mouse) (pORF)
ORF060313	ABM	1.0 ug DNA	EUR 506

Trappc9 ORF Vector (Mouse) (pORF)
ORF060314	ABM	1.0 ug DNA	EUR 506

Trappc9 ORF Vector (Mouse) (pORF)
ORF060315	ABM	1.0 ug DNA	EUR 506

Trappc9 ORF Vector (Mouse) (pORF)
ORF060316	ABM	1.0 ug DNA	EUR 506

Trappc9 ORF Vector (Mouse) (pORF)
ORF060317	ABM	1.0 ug DNA	EUR 506

Trappc9 sgRNA CRISPR Lentivector set (Rat)
K6652001	ABM	3 x 1.0 ug	EUR 339

Trappc9 sgRNA CRISPR Lentivector set (Mouse)
K4631901	ABM	3 x 1.0 ug	EUR 339

TRAPPC9 sgRNA CRISPR Lentivector set (Human)
K2442001	ABM	3 x 1.0 ug	EUR 339

Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
20-abx116143	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
abx145294-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
abx238949-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
20-abx302200	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6652002	ABM	1.0 ug DNA	EUR 154

Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6652003	ABM	1.0 ug DNA	EUR 154

Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6652004	ABM	1.0 ug DNA	EUR 154

Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4631902	ABM	1.0 ug DNA	EUR 154

Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4631903	ABM	1.0 ug DNA	EUR 154

Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4631904	ABM	1.0 ug DNA	EUR 154

TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2442002	ABM	1.0 ug DNA	EUR 154

TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2442003	ABM	1.0 ug DNA	EUR 154

TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2442004	ABM	1.0 ug DNA	EUR 154

TRAPPC9 Protein Vector (Human) (pPB-C-His)
PV137174	ABM	500 ng	Ask for price

TRAPPC9 Protein Vector (Human) (pPB-N-His)
PV137175	ABM	500 ng	Ask for price

TRAPPC9 Protein Vector (Human) (pPM-C-HA)
PV137176	ABM	500 ng	Ask for price

TRAPPC9 Protein Vector (Human) (pPM-C-His)
PV137177	ABM	500 ng	Ask for price

TRAPPC9 Protein Vector (Rat) (pPB-C-His)
PV312766	ABM	500 ng	EUR 1191

TRAPPC9 Protein Vector (Rat) (pPB-N-His)
PV312767	ABM	500 ng	EUR 1191

TRAPPC9 Protein Vector (Rat) (pPM-C-HA)
PV312768	ABM	500 ng	EUR 1191

TRAPPC9 Protein Vector (Rat) (pPM-C-His)
PV312769	ABM	500 ng	EUR 1191

TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241250	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241251	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241252	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPM-C-His)
PV241253	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241254	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241255	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241256	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPM-C-His)
PV241257	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241258	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241259	ABM	500 ng	EUR 1065

TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241260	ABM	500 ng	EUR 1065