RAB5C

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

DLR-RAB5C-Hu-96T 96T
EUR 725.00
  • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

DL-RAB5C-Hu-192 1 kit of 192 tests
EUR 1251.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human RAB5C, Member RAS Oncogene Family (RAB5C)

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

DL-RAB5C-Hu-48 1 kit of 48 tests
EUR 517.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human RAB5C, Member RAS Oncogene Family (RAB5C)

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

DL-RAB5C-Hu-96 1 kit of 96 tests
EUR 695.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human RAB5C, Member RAS Oncogene Family (RAB5C)

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RDR-RAB5C-Hu-48Tests 48 Tests
EUR 589.00

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RDR-RAB5C-Hu-96Tests 96 Tests
EUR 820.00

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RD-RAB5C-Hu-48Tests 48 Tests
EUR 563.00

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RD-RAB5C-Hu-96Tests 96 Tests
EUR 783.00

RAB5C Antibody

1-CSB-PA019215DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB5C Antibody

1-CSB-PA019215DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB5C Antibody

1-CSB-PA097939
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

RAB5C Antibody

1-CSB-PA040136
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RAB5C Antibody

1-CSB-PA041280
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

RAB5C Antibody

36745-100ul 100ul
EUR 252.00

RAB5C antibody

70R-9551 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB5C antibody

RAB5C siRNA

20-abx930697
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB5C siRNA

20-abx930698
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB5C Antibody

DF4406 200ul
EUR 304.00
Description: RAB5C Antibody detects endogenous levels of total RAB5C.

RAB5C Antibody

ABD4406 100 ug
EUR 438.00

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx119126
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx133436
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx006922
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx329139
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx320910
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx320911
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx213565
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

abx216507-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody

20-abx212323
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5C Blocking Peptide

20-abx162145
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB5C Conjugated Antibody

C36745 100ul
EUR 397.00

RAB5C cloning plasmid

CSB-CL019215HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: ATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCAGCTGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAAATCCAGCCTCGTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAATTGGAGCGGCCTTCCT
  • Show more
Description: A cloning plasmid for the RAB5C gene.

RAB5C Blocking Peptide

33R-4673 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5C antibody, catalog no. 70R-9551

RAB5C Polyclonal Antibody

E-AB-12252-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein is a member of the Rab protein family.Members of the Rab protein family are small GTPases of
  • Show more
Description: Rabbit antibody against Human,Mouse RAB5C for WB,ELISA applications.

RAB5C Polyclonal Antibody

E-AB-12252-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein is a member of the Rab protein family.Members of the Rab protein family are small GTPases of
  • Show more
Description: Rabbit antibody against Human,Mouse RAB5C for WB,ELISA applications.

RAB5C Polyclonal Antibody

E-AB-12252-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein is a member of the Rab protein family.Members of the Rab protein family are small GTPases of
  • Show more
Description: Rabbit antibody against Human,Mouse RAB5C for WB,ELISA applications.

RAB5C Blocking Peptide

DF4406-BP 1mg
EUR 195.00

Anti-RAB5C Antibody

A05148 100ul
EUR 397.00
Description: Rabbit Polyclonal RAB5C Antibody. Validated in WB and tested in Human, Mouse, Rat.

RAB5C Rabbit pAb

A7342-100ul 100 ul
EUR 308.00

RAB5C Rabbit pAb

A7342-200ul 200 ul
EUR 459.00

RAB5C Rabbit pAb

A7342-20ul 20 ul
EUR 183.00

RAB5C Rabbit pAb

A7342-50ul 50 ul
EUR 223.00

Anti-RAB5C antibody

STJ13100303 100 µl
EUR 427.00

Anti-Rab5c antibody

STJ140062 150 µg
EUR 231.00
Description: Goat polyclonal antibody to Rab5c. Rab5c belongs to the small GTPase superfamily, Rab family. Rab5c is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis.

Anti-RAB5C antibody

STJ29481 100 µl
EUR 277.00

Human RAB5C, Member RAS Oncogene Family (RAB5C) CLIA Kit

20-abx496137
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

20-abx258183
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.90
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

4-SEP757Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL
  • RAB5CL
  • Ras-related protein Rab-5C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB5C (RAB5C, Member RAS Oncogene Family)

ELK7498 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB5C, Member RAS Oncogene Family (RAB5C). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB5C, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human RAB5C shRNA Plasmid

20-abx953968
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB5C shRNA Plasmid

20-abx972350
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB5C protein (His tag)

80R-2752 100 ug
EUR 322.00
Description: Purified recombinant RAB5C protein (His tag)

Canine RAB5C ELISA KIT

ELI-37953d 96 Tests
EUR 928.00

RAB5C Recombinant Protein (Human)

RP042688 100 ug Ask for price

RAB5C Recombinant Protein (Mouse)

RP166358 100 ug Ask for price

RAB5C Recombinant Protein (Rat)

RP223376 100 ug Ask for price

Monoclonal RAB5C Antibody, Clone: 1616CT314.65.31

AMM07482G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human RAB5C. The antibodies are raised in Mouse and are from clone 1616CT314.65.31. This antibody is applicable in FC, WB, E

Polyclonal RAB5C Antibody (C-term)

AMM07483G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB5C (C-term). This antibody is tested and proven to work in the following applications:

RAB5C ORF Vector (Human) (pORF)

ORF014230 1.0 ug DNA
EUR 354.00

Rab5c ORF Vector (Mouse) (pORF)

ORF055454 1.0 ug DNA
EUR 506.00

Rab5c ORF Vector (Rat) (pORF)

ORF074460 1.0 ug DNA
EUR 506.00

RAB5C, Member RAS Oncogene Family Protein

20-abx261048
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB5C sgRNA CRISPR Lentivector set (Human)

K1769601 3 x 1.0 ug
EUR 339.00

Rab5c sgRNA CRISPR Lentivector set (Mouse)

K4484201 3 x 1.0 ug
EUR 339.00

Rab5c sgRNA CRISPR Lentivector set (Rat)

K6147701 3 x 1.0 ug
EUR 339.00

Human Ras-related protein Rab-5C (RAB5C)

1-CSB-EP019215HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-5C(RAB5C) expressed in E.coli

RAB5C sgRNA CRISPR Lentivector (Human) (Target 1)

K1769602 1.0 ug DNA
EUR 154.00

RAB5C sgRNA CRISPR Lentivector (Human) (Target 2)

K1769603 1.0 ug DNA
EUR 154.00

RAB5C sgRNA CRISPR Lentivector (Human) (Target 3)

K1769604 1.0 ug DNA
EUR 154.00

Rab5c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4484202 1.0 ug DNA
EUR 154.00

Rab5c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4484203 1.0 ug DNA
EUR 154.00

Rab5c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4484204 1.0 ug DNA
EUR 154.00

Rab5c sgRNA CRISPR Lentivector (Rat) (Target 1)

K6147702 1.0 ug DNA
EUR 154.00

Rab5c sgRNA CRISPR Lentivector (Rat) (Target 2)

K6147703 1.0 ug DNA
EUR 154.00

Rab5c sgRNA CRISPR Lentivector (Rat) (Target 3)

K6147704 1.0 ug DNA
EUR 154.00

RAB5C Protein Vector (Rat) (pPB-C-His)

PV297838 500 ng
EUR 603.00

RAB5C Protein Vector (Rat) (pPB-N-His)

PV297839 500 ng
EUR 603.00

RAB5C Protein Vector (Rat) (pPM-C-HA)

PV297840 500 ng
EUR 603.00

RAB5C Protein Vector (Rat) (pPM-C-His)

PV297841 500 ng
EUR 603.00

RAB5C Protein Vector (Human) (pPB-C-His)

PV056917 500 ng
EUR 481.00

RAB5C Protein Vector (Human) (pPB-N-His)

PV056918 500 ng
EUR 481.00

RAB5C Protein Vector (Human) (pPM-C-HA)

PV056919 500 ng
EUR 481.00