PIGG cloning plasmid

CSB-CL711091HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1815
  • Sequence: atgtcagaaagattgcatgggaactggatcagactgtacttggaggaaaagcattcagaagtcctattcaacctgggctccaaggttctcaggcagtacctggatgctctgaagacgctgagcttgtccctgagtgcacaagtggcccagtacgacatctattcgatgatggtgg
  • Show more
Description: A cloning plasmid for the PIGG gene.


PVT12604 2 ug
EUR 391


PVT12829 2 ug
EUR 391

Human PIGG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGG ORF Vector (Human) (pORF)

ORF007816 1.0 ug DNA
EUR 95

Pigg ORF Vector (Mouse) (pORF)

ORF054011 1.0 ug DNA
EUR 506

Pigg sgRNA CRISPR Lentivector set (Mouse)

K3148501 3 x 1.0 ug
EUR 339

PIGG sgRNA CRISPR Lentivector set (Human)

K1647301 3 x 1.0 ug
EUR 339

Pigg sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3148502 1.0 ug DNA
EUR 154

Pigg sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3148503 1.0 ug DNA
EUR 154

Pigg sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3148504 1.0 ug DNA
EUR 154

PIGG sgRNA CRISPR Lentivector (Human) (Target 1)

K1647302 1.0 ug DNA
EUR 154

PIGG sgRNA CRISPR Lentivector (Human) (Target 2)

K1647303 1.0 ug DNA
EUR 154

PIGG sgRNA CRISPR Lentivector (Human) (Target 3)

K1647304 1.0 ug DNA
EUR 154

PIGG Protein Vector (Human) (pPB-C-His)

PV031261 500 ng
EUR 329

PIGG Protein Vector (Human) (pPB-N-His)

PV031262 500 ng
EUR 329

PIGG Protein Vector (Human) (pPM-C-HA)

PV031263 500 ng
EUR 329

PIGG Protein Vector (Human) (pPM-C-His)

PV031264 500 ng
EUR 329

PIGG Protein Vector (Mouse) (pPB-C-His)

PV216042 500 ng
EUR 1065

PIGG Protein Vector (Mouse) (pPB-N-His)

PV216043 500 ng
EUR 1065

PIGG Protein Vector (Mouse) (pPM-C-HA)

PV216044 500 ng
EUR 1065

PIGG Protein Vector (Mouse) (pPM-C-His)

PV216045 500 ng
EUR 1065

Pigg 3'UTR Luciferase Stable Cell Line

TU116349 1.0 ml Ask for price

Pigg 3'UTR GFP Stable Cell Line

TU166349 1.0 ml Ask for price

Pigg 3'UTR Luciferase Stable Cell Line

TU216227 1.0 ml Ask for price

Pigg 3'UTR GFP Stable Cell Line

TU266227 1.0 ml Ask for price

PIGG 3'UTR GFP Stable Cell Line

TU067933 1.0 ml
EUR 1521

PIGG 3'UTR Luciferase Stable Cell Line

TU017933 1.0 ml
EUR 1521

Human GPI ethanolamine phosphate transferase 2, PIGG ELISA KIT

ELI-20960h 96 Tests
EUR 824

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3148505 3 x 1.0 ug
EUR 376

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1647305 3 x 1.0 ug
EUR 376

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3148506 1.0 ug DNA
EUR 167

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3148507 1.0 ug DNA
EUR 167

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3148508 1.0 ug DNA
EUR 167

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1647306 1.0 ug DNA
EUR 167

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1647307 1.0 ug DNA
EUR 167

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1647308 1.0 ug DNA
EUR 167