POM121 Transmembrane Nucleoporin (POM121) Antibody
20-abx121664
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

POM121 Transmembrane Nucleoporin (POM121) Antibody
20-abx217265
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 Transmembrane Nucleoporin (POM121) Antibody
abx236636-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

POM121 siRNA
20-abx904132
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 Antibody
ABD8708 100 ug
EUR 438.00

POM121 siRNA
20-abx929246
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 siRNA
20-abx929247
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 Antibody
45454-100ul 100ul
EUR 252.00

POM121 Antibody
45454-50ul 50ul
EUR 187.00

POM121 Antibody
DF8708 200ul
EUR 304.00
Description: POM121 Antibody detects endogenous levels of total POM121.

Human POM121 Transmembrane Nucleoporin (POM121) ELISA Kit
abx382368-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

POM121 Conjugated Antibody
C45454 100ul
EUR 397.00

POM121 Polyclonal Antibody
ES8121-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against POM121 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

POM121 Polyclonal Antibody
ES8121-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against POM121 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- POM121 antibody
FNab06636 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: POM121 membrane glycoprotein(rat)
  • Uniprot ID: Q96HA1
  • Gene ID: 9883
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against POM121

POM121 Polyclonal Antibody
ABP57122-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Polyclonal Antibody
ABP57122-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Polyclonal Antibody
ABP57122-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Blocking Peptide
20-abx161374
  • EUR 606.00
  • EUR 1428.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-POM121 Antibody
A06856 100ul
EUR 397.00
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

POM121 Blocking Peptide
DF8708-BP 1mg
EUR 195.00

POM121 cloning plasmid
CSB-CL846630HU-10ug 10ug
EUR 558.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2955
  • Sequence: atggtgtgtagcccagtgactgtgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaacgccccagacccatgtgcaaaggagacagtactgagtgccctcaaagagaaggagaagaaaagga
  • Show more
Description: A cloning plasmid for the POM121 gene.

Anti-POM121 antibody
PAab06636 100 ug
EUR 355.00

Anti-POM121 antibody
STJ95184 200 µl
EUR 197.00
Description: Rabbit polyclonal to POM121.

Mouse POM121 shRNA Plasmid
20-abx979852
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat POM121 shRNA Plasmid
20-abx987135
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Pom121 ELISA KIT
ELI-19702m 96 Tests
EUR 865.00

Human POM121 ELISA KIT
ELI-16147h 96 Tests
EUR 824.00

POM121 ELISA KIT|Human
EF001946 96 Tests
EUR 689.00

POM121 / POM121B / POM121C Antibody
20-abx328797
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human POM121 shRNA Plasmid
20-abx956630
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

POM121/POM121B/POM121C Antibody
1-CSB-PA080085
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POM121/POM121B/POM121C. Recognizes POM121/POM121B/POM121C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

POM121 And ZP3 Fusion Protein
20-abx261350
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

POM121 ORF Vector (Human) (pORF)
ORF008045 1.0 ug DNA
EUR 95.00

Pom121 ORF Vector (Rat) (pORF)
ORF073803 1.0 ug DNA
EUR 506.00

Pom121 ORF Vector (Mouse) (pORF)
ORF054481 1.0 ug DNA
EUR 506.00

POM121 sgRNA CRISPR Lentivector set (Human)
K1685801 3 x 1.0 ug
EUR 339.00

Pom121 sgRNA CRISPR Lentivector set (Mouse)
K3065201 3 x 1.0 ug
EUR 339.00

Pom121 sgRNA CRISPR Lentivector set (Rat)
K7587501 3 x 1.0 ug
EUR 339.00

POM121 And ZP3 Fusion Protein (POMZP3) Antibody
abx036508-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody
abx030287-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody
abx030287-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

POM121 sgRNA CRISPR Lentivector (Human) (Target 1)
K1685802 1.0 ug DNA
EUR 154.00

POM121 sgRNA CRISPR Lentivector (Human) (Target 2)
K1685803 1.0 ug DNA
EUR 154.00

POM121 sgRNA CRISPR Lentivector (Human) (Target 3)
K1685804 1.0 ug DNA
EUR 154.00

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3065202 1.0 ug DNA
EUR 154.00

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3065203 1.0 ug DNA
EUR 154.00

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3065204 1.0 ug DNA
EUR 154.00

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7587502 1.0 ug DNA
EUR 154.00

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7587503 1.0 ug DNA
EUR 154.00

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7587504 1.0 ug DNA
EUR 154.00

POM121 Protein Vector (Human) (pPB-C-His)
PV032177 500 ng
EUR 329.00

POM121 Protein Vector (Human) (pPB-N-His)
PV032178 500 ng
EUR 329.00

POM121 Protein Vector (Human) (pPM-C-HA)
PV032179 500 ng
EUR 329.00

POM121 Protein Vector (Human) (pPM-C-His)
PV032180 500 ng
EUR 329.00