POM121 Transmembrane Nucleoporin (POM121) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Pom121/ Rat Pom121 ELISA Kit

ELI-21714r 96 Tests
EUR 886

POM121 Transmembrane Nucleoporin (POM121) Antibody

abx236636-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

POM121 Antibody

45454-100ul 100ul
EUR 252

POM121 Antibody

45454-50ul 50ul
EUR 187

POM121 Antibody

DF8708 200ul
EUR 304
Description: POM121 Antibody detects endogenous levels of total POM121.

POM121 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POM121 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POM121 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POM121 Antibody

ABD8708 100 ug
EUR 438

Human POM121 Transmembrane Nucleoporin (POM121) ELISA Kit

abx382368-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

POM121 Blocking Peptide

DF8708-BP 1mg
EUR 195

POM121 Blocking Peptide

  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

POM121 Conjugated Antibody

C45454 100ul
EUR 397

POM121 cloning plasmid

CSB-CL846630HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2955
  • Sequence: atggtgtgtagcccagtgactgtgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaacgccccagacccatgtgcaaaggagacagtactgagtgccctcaaagagaaggagaagaaaagga
  • Show more
Description: A cloning plasmid for the POM121 gene.

POM121 Polyclonal Antibody

ABP57122-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Polyclonal Antibody

ABP57122-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Polyclonal Antibody

ABP57122-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

anti- POM121 antibody

FNab06636 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: POM121 membrane glycoprotein(rat)
  • Uniprot ID: Q96HA1
  • Gene ID: 9883
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against POM121

POM121 Polyclonal Antibody

ES8121-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against POM121 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

POM121 Polyclonal Antibody

ES8121-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against POM121 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-POM121 antibody

PAab06636 100 ug
EUR 355

Anti-POM121 antibody

STJ95184 200 µl
EUR 197
Description: Rabbit polyclonal to POM121.

POM121/POM121B/POM121C Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POM121/POM121B/POM121C. Recognizes POM121/POM121B/POM121C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000


ELI-16147h 96 Tests
EUR 824

Mouse Pom121 ELISA KIT

ELI-19702m 96 Tests
EUR 865


EF001946 96 Tests
EUR 689

Rat POM121 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POM121 / POM121B / POM121C Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human POM121 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse POM121 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POM121 And ZP3 Fusion Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Pom121 ORF Vector (Rat) (pORF)

ORF073803 1.0 ug DNA
EUR 506

POM121 ORF Vector (Human) (pORF)

ORF008045 1.0 ug DNA
EUR 95

Pom121 ORF Vector (Mouse) (pORF)

ORF054481 1.0 ug DNA
EUR 506

Pom121 sgRNA CRISPR Lentivector set (Rat)

K7587501 3 x 1.0 ug
EUR 339

Pom121 sgRNA CRISPR Lentivector set (Mouse)

K3065201 3 x 1.0 ug
EUR 339

POM121 sgRNA CRISPR Lentivector set (Human)

K1685801 3 x 1.0 ug
EUR 339

POM121 And ZP3 Fusion Protein (POMZP3) Antibody

abx036508-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody

abx030287-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody

abx030287-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7587502 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7587503 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7587504 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3065202 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3065203 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3065204 1.0 ug DNA
EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 1)

K1685802 1.0 ug DNA
EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 2)

K1685803 1.0 ug DNA
EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 3)

K1685804 1.0 ug DNA
EUR 154

POM121 Protein Vector (Rat) (pPB-C-His)

PV295210 500 ng
EUR 1191

POM121 Protein Vector (Rat) (pPB-N-His)

PV295211 500 ng
EUR 1191

POM121 Protein Vector (Rat) (pPM-C-HA)

PV295212 500 ng
EUR 1191

POM121 Protein Vector (Rat) (pPM-C-His)

PV295213 500 ng
EUR 1191