POM121

POM121 Transmembrane Nucleoporin (POM121) Antibody
20-abx121664	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Pom121/ Rat Pom121 ELISA Kit
ELI-21714r	Lifescience Market	96 Tests	EUR 886

POM121 Transmembrane Nucleoporin (POM121) Antibody
abx236636-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

POM121 Antibody
45454-100ul	SAB	100ul	EUR 252

POM121 Antibody
45454-50ul	SAB	50ul	EUR 187

POM121 Antibody
DF8708	Affbiotech	200ul	EUR 304
Description: POM121 Antibody detects endogenous levels of total POM121.

POM121 siRNA
20-abx904132	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POM121 siRNA
20-abx929246	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POM121 siRNA
20-abx929247	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POM121 Antibody
ABD8708	Lifescience Market	100 ug	EUR 438

Human POM121 Transmembrane Nucleoporin (POM121) ELISA Kit
abx382368-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Anti-POM121 Antibody
A06856	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

POM121 Blocking Peptide
DF8708-BP	Affbiotech	1mg	EUR 195

POM121 Blocking Peptide
20-abx161374	Abbexa	EUR 606.00 EUR 1428.00	1 mg 5 mg
Shipped within 5-10 working days.

POM121 Conjugated Antibody
C45454	SAB	100ul	EUR 397

POM121 cloning plasmid
CSB-CL846630HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2955 Sequence: atggtgtgtagcccagtgactgtgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaacgccccagacccatgtgcaaaggagacagtactgagtgccctcaaagagaaggagaagaaaagga Show more
Description: A cloning plasmid for the POM121 gene.

POM121 Polyclonal Antibody
ABP57122-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250 Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Polyclonal Antibody
ABP57122-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250 Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

POM121 Polyclonal Antibody
ABP57122-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250 Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

anti- POM121 antibody
FNab06636	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: POM121 membrane glycoprotein(rat) Uniprot ID: Q96HA1 Gene ID: 9883 Research Area: Cell Division and Proliferation
Description: Antibody raised against POM121

POM121 Polyclonal Antibody
ES8121-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against POM121 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

POM121 Polyclonal Antibody
ES8121-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against POM121 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-POM121 antibody
PAab06636	Lifescience Market	100 ug	EUR 355

Anti-POM121 antibody
STJ95184	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to POM121.

POM121/POM121B/POM121C Antibody
1-CSB-PA080085	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POM121/POM121B/POM121C. Recognizes POM121/POM121B/POM121C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Human POM121 ELISA KIT
ELI-16147h	Lifescience Market	96 Tests	EUR 824

Mouse Pom121 ELISA KIT
ELI-19702m	Lifescience Market	96 Tests	EUR 865

POM121 ELISA KIT|Human
EF001946	Lifescience Market	96 Tests	EUR 689

Rat POM121 shRNA Plasmid
20-abx987135	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POM121 / POM121B / POM121C Antibody
20-abx328797	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human POM121 shRNA Plasmid
20-abx956630	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse POM121 shRNA Plasmid
20-abx979852	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POM121 And ZP3 Fusion Protein
20-abx261350	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Pom121 ORF Vector (Rat) (pORF)
ORF073803	ABM	1.0 ug DNA	EUR 506

POM121 ORF Vector (Human) (pORF)
ORF008045	ABM	1.0 ug DNA	EUR 95

Pom121 ORF Vector (Mouse) (pORF)
ORF054481	ABM	1.0 ug DNA	EUR 506

Pom121 sgRNA CRISPR Lentivector set (Rat)
K7587501	ABM	3 x 1.0 ug	EUR 339

Pom121 sgRNA CRISPR Lentivector set (Mouse)
K3065201	ABM	3 x 1.0 ug	EUR 339

POM121 sgRNA CRISPR Lentivector set (Human)
K1685801	ABM	3 x 1.0 ug	EUR 339

POM121 And ZP3 Fusion Protein (POMZP3) Antibody
abx036508-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody
abx030287-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody
abx030287-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7587502	ABM	1.0 ug DNA	EUR 154

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7587503	ABM	1.0 ug DNA	EUR 154

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7587504	ABM	1.0 ug DNA	EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3065202	ABM	1.0 ug DNA	EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3065203	ABM	1.0 ug DNA	EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3065204	ABM	1.0 ug DNA	EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 1)
K1685802	ABM	1.0 ug DNA	EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 2)
K1685803	ABM	1.0 ug DNA	EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 3)
K1685804	ABM	1.0 ug DNA	EUR 154

POM121 Protein Vector (Rat) (pPB-C-His)
PV295210	ABM	500 ng	EUR 1191

POM121 Protein Vector (Rat) (pPB-N-His)
PV295211	ABM	500 ng	EUR 1191

POM121 Protein Vector (Rat) (pPM-C-HA)
PV295212	ABM	500 ng	EUR 1191

POM121 Protein Vector (Rat) (pPM-C-His)
PV295213	ABM	500 ng	EUR 1191